Recombinant lentivirus-based vector for implementing RNA (Ribose Nucleic Acid) interference aiming at FLG (filaggrin) gene and preparation of recombinant lentivirus-based vector

A recombinant lentivirus, RNA interference technology, applied in the field of molecular biology, can solve the problem that non-viral vectors cannot meet the long-term expression and other problems

Inactive Publication Date: 2012-07-25
党宁宁
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] At present, the vectors for gene therapy mainly include non-viral vectors and viral vectors. However, non-viral vectors cannot satisfy long-term expression, and this defect is undoubtedly filled by viral vectors.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant lentivirus-based vector for implementing RNA (Ribose Nucleic Acid) interference aiming at FLG (filaggrin) gene and preparation of recombinant lentivirus-based vector
  • Recombinant lentivirus-based vector for implementing RNA (Ribose Nucleic Acid) interference aiming at FLG (filaggrin) gene and preparation of recombinant lentivirus-based vector
  • Recombinant lentivirus-based vector for implementing RNA (Ribose Nucleic Acid) interference aiming at FLG (filaggrin) gene and preparation of recombinant lentivirus-based vector

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0072] Example 1: Construction of lentiviral vector for gene FLG

[0073] 1. Design and synthesis of oligonucleotides

[0074] Using Invitrogen's online RNAi series design software BLOCK-iT RNAi Designer, design 3 interference target sequences (see the table below) for the FLG gene mRNA sequence (NM-002016.1), and synthesize the corresponding double-stranded DNA (Shanghai Sangon Biotechnology Co., Ltd. Engineering Technology Services Ltd). The loop structure in the LV3-shRNA template uses TTCAAGAGA to avoid the formation of termination signals. GATCC was added to the 5' end of the sense strand template, which was complementary to the sticky end formed after digestion with BamHI; AATTC was added to the 5' end of the antisense strand template, which was complementary to the sticky end formed after EcoRI digestion.

[0075] serial code

sequence name

target sequence

C721

FLG-homo-274

GTTGGCTCAAGCATATTATTT

C722

FLG-homo-769

CACCA...

Embodiment 2

[0114] Example 2: Coating of FLG gene RNA interference recombinant lentivirus

[0115] Take the recombinant virus plasmid PGLV / H1 / GFP-sh FLG (20 μg) prepared by high-purity endotoxin-free extraction, helper plasmids pHelper1.0 (15 μg) and pHelper 2.0 (10 μg), and carry out co-production according to the instructions of Invitrogen Company Lipofectamine 2000. Transfect 293T cells.

[0116] 8 hours after transfection, replace with complete medium, at 37°C, 5% CO 2 After continuing to culture in the incubator for 48 hours, the cell supernatant rich in lentiviral particles was collected. Centrifuge at 4000g for 10 minutes at 4°C to remove cell debris and filter the supernatant with a 0.45 μM filter to obtain lentivirus for use, which can meet general cell experiments. If you want to obtain a higher concentration of lentivirus, you can further concentrate and purify it to obtain a high-titer lentivirus concentrate. Pack the virus concentrate and store it at -80°C for a long time. ...

Embodiment 3

[0127] Example 3: Target cell invasion test and gene expression inhibition effect analysis

[0128] 1. Target cell invasion test

[0129] Carry out the virus infection experiment on human normal skin cells HACAT according to the following steps:

[0130] 1) When HACAT cells are cultured to 80-90% confluence in a 10 cm culture dish, the culture medium is poured off, and the cells are washed twice with 3 ml of D-Hank's solution.

[0131] 2) Add 1ml of Trypsin-EDTA solution (0.05%, Gibco), mix well, carefully suck off the trypsin solution, and place it at 37°C for 3-5 minutes.

[0132] 3) Add 2ml of DMEM culture medium and pipette to make the cells form a single-cell suspension.

[0133] 4) Count on a blood cell counting board, according to 10×10 5 Inoculate a 6-well plate at the concentration of cells / well and mix well at 37°C 5% CO 2 Incubate for 24 hours.

[0134] 5) Dilute 200 ul of lentivirus stock solution five times with 10% FBS DMEM culture solution.

[0135] 6) Asp...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a recombinant lentivirus-based vector for implementing the RNA (Ribose Nucleic Acid) interference aiming at an FLG (filaggrin) gene and preparation of the recombinant lentivirus-based vector. A lentivirus-based vector of shRNA (shorthairpin RNA) aiming at the FLG gene is constructed through experiments; a synthesized DNA fragment aiming at the ShRNA is mediated by the lentivirus-based vector; 293T cells are subjected to co-transfection together by the lentivirus-based vector and two vectors pHelper1.0 and pHelper2.0 to carry out culture; and after the recombinant lentivirus-based vector is obtained, target cells are subjected to transfection so as to implement the RNA interference aiming at the FLG gene. The adopted self-inactivated third-generation lentivirus-based vector has the advantages of safety, reliability, capability of infecting nondividing cells, long-term expression of integrating a target gene to a target cell gene, small immune response and the like and is an ideal vector. The lentivirus-based vector disclosed by the invention has the interference effect reaching 75 to 95 percent on normal skin cells HACAT of people, and thus, the recombinant lentivirus-based vector disclosed by the invention lays a good experimental foundation for further research related to the FLG gene and can be widely used for the in-vivo gene therapy and the gene functional research.

Description

technical field [0001] The invention belongs to the technical fields of molecular biology, biomedicine and genetic engineering, and mainly relates to an RNA interference recombinant lentiviral vector (LV-sh-FLG) for filaggrin (FLG) gene and its preparation. Background technique [0002] Atopic dermatitis (AD) is a genetically related, complex, itchy, chronic inflammatory skin disease. The etiology and pathogenesis of AD are complex, and there is a lack of effective treatment, which seriously affects the quality of life of infants and adults. It is currently believed that the characteristic clinical manifestations of AD are the result of the interaction of susceptibility genes, environmental factors, defective skin barrier function, and immunological abnormalities. In recent years, the role of genetics in the pathogenesis of AD has become a research hotspot. In recent years, the research on the susceptibility regions has made a certain degree of progress. Recently, many st...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/867C12N15/66
Inventor党宁宁逄曙光马晓丽边红初晶学
Owner党宁宁