Establishing method of bifidobacterium functional gene no-trace knockout method

A bifidobacteria, functional gene technology, applied in microorganism-based methods, biochemical equipment and methods, bacteria, etc., can solve the problems of limiting research progress in the field of bifidobacteria genetic engineering, difficult gene manipulation, and cell wall thickness, etc. The effect of avoiding the application of antibiotics

Inactive Publication Date: 2014-11-26
NANCHANG UNIV
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, as a Gram-positive bacterium, bifidobacteria have a thick cell wall, and it has always been difficult to genetically manipulate it, which limits the research progress in the field of bifidobacteria genetic engineering.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Establishing method of bifidobacterium functional gene no-trace knockout method
  • Establishing method of bifidobacterium functional gene no-trace knockout method
  • Establishing method of bifidobacterium functional gene no-trace knockout method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Example 1: Construction of Bifidobacterium Targeting Vector and Shuttle Expression Vector:

[0039] 1. In view of the characteristics of the LoxP site sequence, two LoxP sites with the same orientation were directly synthesized on the pUC57 vector, and the sequence (108 bp in total) was from Eco R V sites and Pst I site insertion, after which the spectinomycin resistance gene will be inserted from the middle and both ends of the two LoxP sites respectively spc and upstream and downstream homology arm sequences.

[0040] This step constructs the vector pUC57-LoxP. The synthetic sequences of the two LoxP sites are:

[0041] 5'-CGG ACTAGT ATAACTTCGTATAATGTATGCTATACGAAGTTAT CTCGAG AACGATCGGTT GGGCCC ATAACTTCGTATAATGTATGCTATACGAAGTTAT AGATCT CC-3'(SEQ ID.NO.1), the endonucleases are Speech I, xho I, Apa I, Bgl II.

[0042] 2. Using the pER8 plasmid as a template, design the primer P-Spc-F: 5’-CCG CTCGAG TGGTCCAGAACCTTGACCG-3'( xho I), (SEQ. ID....

Embodiment 2

[0051] Embodiment 2: the preparation and transformation of Bifidobacterium longum protoplast:

[0052] 1. Transformation of targeting vector: transfer Bifidobacterium longum NCC2705 from a glycerol tube stored at -70°C to an MRS plate (MRS agar medium: 10 g peptone, 10 g beef extract, 5 g yeast extract, Tween-80 1 g, K 2HPO 4 2 g CH 3 COONa·3H 2 O 5 g, triammonium citrate 2 g, MgSO 4· 7H 2 O 0.2 g, MnSO 4· h 2 O 0.05 g, Agar 15 g, glucose 20 g, add distilled water to 1000 mL, adjust the pH to 6.2-6.4, and autoclave at 121 °C for 15 min. MRS broth medium: the composition is the same as above without adding agar), cultured anaerobically at 37°C for 24 h. Pick a single colony from the plate, inoculate it in 5 mL MRS liquid medium, and culture it anaerobically at 37 °C for 24 h; then transfer it to fresh 25 mL MRS liquid medium , anaerobic culture at 37°C for 24 hours; centrifuge to collect the bacteria, resuspend; add mutanolysin to a final concentration of 4.5-5.5 mg / L...

Embodiment 3

[0056] Example 3: Bifidobacteria serpin Verification of gene deletion strains:

[0057] 1. to ⊿serpin⊿spc strain genomic DNA as a template, amplified with primers serpin-F / R (SEQ. ID.NO.11 and SEQ. ID.NO.12) serpin Gene (amplification system and reaction procedure are the same as step 2 in Example 2), detected during recombination serpin Changes in gene signal; amplified with primers SEQ.ID.NO.2 and SEQ.ID.NO.3 spc Gene, detection of shuttle expression vector before and after transformation spc gene signal. Figure 10 It is the result of PCR verification after step-by-step transformation, after serpin PCR amplification of gene deletion fragments and 1% agarose gel electrophoresis, showing ⊿serpin The strain can amplify 1000 bp, indicating that the transformant genome contains spc Gene; ⊿serpin The strain failed to amplify the 1400 bp fragment, indicating that homologous recombination occurred between the targeting fragment and the homologous fragment on the c...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an establishing method of a bifidobacterium functional gene no-trace knockout method. The establishing method comprises the following steps of: constructing a serpin gene suicide type targeting vector UPD; loading a promoter of the bifidobacterium by using pDG7 as a framework to construct a bifidobacterium-escherichia coli shuttle expression vector pDG-Hup; constructing a bifidobacterium-escherichia coli shuttle expression vector Pdg-hup-cre of a Cre enzyme gene based on pDG-Hup; transferring the targeting vector into the bifidobacterium and obtaining a bifidobacterium serpin gene defective strain through homologous recombination; and removing the spectinomycin spc gene introduced in the bifidobacterium genome by utilizing a site-specific recombination Cre-loxp system to realize no-trace knockout of the bifidobacterium resistance gene. The establishing method of the bifidobacterium functional gene no-trace knockout method disclosed by the invention is used for obtaining the defective strain of the bifidobacterium functional gene by utilizing a homologous recombination principle, can be applied to the knockout of the bifidobacterium functional gene and can be used for improving the strains.

Description

technical field [0001] The invention belongs to the application in genetic engineering of bifidobacteria, and in particular relates to a method for knocking out functional genes of bifidobacteria without trace. Background technique [0002] Gene knockout is a way of modifying endogenous genes by using the principle of DNA homologous recombination, so that recombination occurs between the exogenous DNA and the homologous sequence of the target gene on the genomic DNA of the recipient cell, and the exogenous carrier DNA is integrated at a specific point On the predetermined site of the target gene, or by replacing it with a certain DNA segment of the target gene, the precise modification and transformation of the genomic DNA target gene is completed, resulting in a mutation in the structure or composition of the target gene, resulting in the loss of gene function, and the modified and The engineered gene can replicate stably along with the replication of genomic DNA. It has t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/74C12N1/21C12R1/01
Inventor万翠香魏华夏慧玲许恒毅章昭琳
OwnerNANCHANG UNIV