Actinobacillus succinogenes gene knock-out method

A technology of actinomycetes and succinic acid, applied in the field of genetic engineering and metabolic engineering transformation, can solve the problems of restricting the wide application of basic chemical raw materials, environmental pollution, high cost, etc., and achieve excellent production performance, promote research progress, and high conversion efficiency Effect

Active Publication Date: 2018-04-17
NANJING UNIV OF TECH
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] The traditional chemical synthesis of succinic acid uses butane to be produced by electrolysis through maleic anhydride, which has problems such as high cost and environmental pollution, which limits its wide application as a basic chemical raw material

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Actinobacillus succinogenes gene knock-out method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] This embodiment specifically illustrates the pyruvate formate lyase gene in Actinobacillus succinate NJ113 PPML The construction method of the left and right homology arms comprises the following steps:

[0027] (1) Design PCR amplification primers to construct left and right homology arms:

[0028] Left arm upstream primer: GACTAGTCTAGCGCAAGGCTAACGGTGCTTC

[0029] Left arm downstream primer: ATAACGTCTTGTTGCTGTTCGCGTTCCTGCCATTCACCGGGAACGA

[0030] Right arm upstream primer: TCGTTCCCGGTGAATGGCAGGAACGCGAACAGCAACAAGACGTTAT

[0031] Right arm downstream primer: GACTAGTCGATACCGCGGCTTACATTACGGC

[0032] (2) Using the left-arm upstream primer and the left-arm downstream primer to generate pyruvate formate lyase gene in Actinobacillus succinobacterium NJ113 PPML The homologous left arm was amplified for the template PCR, and the right arm upstream primer and the right arm downstream primer were used to produce pyruvate formate lyase gene in Actinobacillus succinate NJ113 ...

Embodiment 2

[0036] This embodiment specifies PPML The method for screening the correct positive single clone of the suicide plasmid pJC4 with left and right homologous arms:

[0037] select Sac Ⅰ As a restriction site, the suicide plasmid pJC4 was single-digested, and cloned by one-step cloning PPML The left and right homologous arms were connected to the suicide plasmid pJC4. Take 20uL of the enzyme-linked reaction product and add it to 100uL of the suicide plasmid donor bacteria Donor competent cells. Mix well by flicking the tube wall a few times, place on ice for 30 min, and heat shock at 42°C. For 45-90 seconds, incubate in an ice-water bath for 2 minutes, add 900uLSOC or LB medium, shake the bacteria at 37°C for 45 minutes, centrifuge at 4500r / min for 3 minutes, discard 900uL of the supernatant, leave 100uL of resuspended bacteria, and spread evenly on chloramphenicol for screening On the LA plate with a concentration of 25ug / mL. Invert the plate and culture overnight at 37°C....

Embodiment 3

[0041] This example specifically illustrates the construction of Actinobacillus succinate NJ113 △pflB Screening method for recombinant strains:

[0042] (1) Take 100uL each of the overnight bacteria of Donor and Actinobacillus succinogenes NJ113, add to the same EP tube, mix well, and centrifuge at 4500r / min for 3min;

[0043] (2) Resuspend the mixed bacteria in (1) with 10uL LB, and spot 2-3 spots of the 10uL bacteria on the LA plate coated with 2,6-diaminopimelic acid without chloramphenicol resistance , after drying the bacterial solution, place it in an incubator at 37°C for more than 15 hours;

[0044] (3) Pick the plaque on the plate in (2) and wash it once with LB in the EP tube, resuspend it and apply it on an LA plate with a chloramphenicol screening concentration of 5ug / mL and culture it in an incubator at 37°C until a single colony grows on the plate Colony;

[0045] (4) Pick the monoclonal colony in (3) to LB for overnight culture, use 20% glycerol to preserve ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an actinobacillus succinogenes gene knock-out method. The method comprises the following steps: constructing left and right homologous arms of target genes; constructing suicide plasmids with antibiotic screening markers and negative screening markers; connecting the left and right homologous arms of target genes with the suicide plasmids, transferring into donor strain competent cells, screening accurate positive mono-clones by virtue of resistant spread-plate, and performing sequencing validation; and transferring the accurate positive mono-clones into objective strains actinobacillus succinogenes, screening single-crossing-over positive mono-clones in the resistant spread-plate, and performing negative screening on the positive mono-clones subjected to accurate single-crossing-over, thereby obtaining the recombinant strain with target gene deletion. The method disclosed by the invention is specified at actinobacillus succinogenes gene knock-out genes, and issimple in operation, high in conversion rate, applicable to multi-gene knock-out and capable of realizing non-trace knock-out of the target genes.

Description

technical field [0001] The invention relates to the field of genetic engineering and metabolic engineering transformation, in particular to a high-efficiency gene knockout method for Actinobacillus succinate. Background technique [0002] Succinic acid (also known as succinic acid) is a common natural organic acid widely found in human body, animals, plants and microorganisms. As an important chemical raw material, it is also widely used in pharmaceutical, food and surfactant industries. Succinic acid can be used as an intermediate in the synthesis of complex organic compounds, and also as a C 4 Platform compounds are used in the synthesis of bulk chemicals and biodegradable materials, so succinic acid is considered to be the most marketable fermented organic acid product after citric acid. [0003] The traditional chemical synthesis of succinic acid is produced by electrolysis of butane through maleic anhydride, which has problems such as high cost and environmental pollu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12N15/74C12N15/65C12R1/01
CPCC12N15/65C12N15/74
Inventor姜岷朱君如信丰学章文明董维亮马江锋
OwnerNANJING UNIV OF TECH