Traceless fixed-point transformation method of large gene cluster and application of traceless fixed-point transformation method

A technology of fixed-point transformation and gene clustering, applied in the field of molecular biology, can solve the problems of low transformation efficiency of Saccharopolyspora spinosa and obstacles to the application of combinatorial biosynthesis technology

Active Publication Date: 2021-09-07
SHANDONG UNIV
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the extremely low transformation efficiency of S. spinosa hampers the application of combinatorial biosynthesis in the derivation of spinosad structures

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Traceless fixed-point transformation method of large gene cluster and application of traceless fixed-point transformation method
  • Traceless fixed-point transformation method of large gene cluster and application of traceless fixed-point transformation method
  • Traceless fixed-point transformation method of large gene cluster and application of traceless fixed-point transformation method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0074] Example 1. Using RedEx technology to seamlessly insert the busA AT1b-KS1a domain into the spnA gene

[0075] 1. Preparation of NDA fragment ampccdB-busA20 carrying a 20bp terminal homology arm:

[0076] Use the pR6K-oriT-phiC31 plasmid as a template for PCR amplification. The primers for PCR amplification are as follows, and the underline is the BstZ17I restriction site:

[0077] R6K-2: 5'-AACGCGCTGCGTGAATCTTCCGCCGGCGACATGGGCAGGCGTGTCGAAGCGAAGTTCTGGGGCGCCGTCGAGCACGAAGA GTATAC AGTTCAACCTGTTGATAGTACG-3',

[0078] R6K-3: 5'-CCAGAAGTCGGCTCATCCACGTGCAACGTGCGCGGTAGCTGCCCGTGCCGCATCGCCATCACCATCTTCATGACGCCGGC GTATAC TGTCAGCCGTTAAGTGTTCCTGTG-3',

[0079] Then use the above PCR product as a template to carry out PCR amplification to obtain the R6K replicon. The primers for PCR amplification are as follows:

[0080] R6K-1: 5'-GCTGCCCACCTACGCCTTCCAACGACAGCGGTACTGGCTGAACGCGCTGCGTGAATCTTC-3',

[0081] R6K-3: 5'-CCAGAAGTCGGCTCATCCACGTGCAACGTGCGCGGTAGCTGCCCGTGCCGCATCGCCATCACCATCT...

Embodiment 2

[0090] Embodiment 2, heterologous expression of butenyl spinosyn

[0091] 1. Product Analysis of Butenyl Spinosad by High Performance Liquid Chromatography-Mass Spectrometry (HPLC-MS)

[0092] The recombinant pBAC-spnNEWbusA was integrated into the attB site of Streptomyces albicans J1074 genome by conjugative transfer and PhiC31 site-specific recombination. The plate-activated Streptomyces albus J1074 recombinant strain was inoculated into 30 mL of trypticase soy medium (TSB medium), cultivated at 30° C. and 220 rpm for 72 h, and then inoculated with 1% of the inoculum into 3 L of fermentation medium (4 % glucose, 1% glycerin, 3% soluble starch, 1.5% soybean peptone, 1% beef extract, 0.65% peptone, 0.05% yeast extract, 0.1% magnesium sulfate heptahydrate, 0.2% sodium chloride and 0.24% calcium carbonate) In a 5L fermenter (Shanghai Bailun Biotechnology Co., Ltd.), set the stirrer speed at 500rpm, ferment at 30°C for 10 days, and feed 36mL 500g L every day through a peristalt...

Embodiment 3

[0101] Example 3. Using RedEx technology to seamlessly knock out the spnK gene on the spinosyn gene cluster

[0102] After inactivation of the spnK gene (GenBank ID: AY007564.1) of the spinosyn gene cluster, the Saccharopolyspora spinosa mutant can synthesize spinosyn J and spinosyn L (3'-oxo-demethyl spinosyn A / D), spinosyn J and spinosyn L are important raw materials for the synthesis of spinetoram.

[0103] 1. Preparation of the ampccdB traceless modified gene cassette carrying a 20bp terminal homology arm:

[0104] Use the p15A-ccdB-amp plasmid as a template for PCR amplification to obtain the ampccdB traceless modified gene cassette. The primers for PCR amplification are as follows, and the underline is the PacI restriction site:

[0105] delKampccdB-1: 5'-TTGAGCAGGTCCAGGTACAGCGCGTTCTGGGAGGGCATGTCAATTCCTCCTCAGCCGCCCTCGACGCCGA TTAATTAA TTTGTTTATTTTTCTAAATAC-3',

[0106] delKampccdB-2: 5'-CCGCGCCGGGGTTCGTGCCCCGGCAAGCGCTCGGCGTCGAGGGCGGCTGA T TAATTAA TTTGTTCAAAAAAAAGCC...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a traceless fixed-point transformation method of a large gene cluster and application of the traceless fixed-point transformation method. The traceless fixed-point transformation method comprises the following steps: firstly, inserting a gene cassette containing target DNA-forward selection marker-reverse selection marker into a target site by utilizing Red alpha beta line loop recombination to obtain a recombinant vector, wherein two sides of the forward selection marker-reverse selection marker are provided with specific restriction enzyme cutting sites and end homologous arms; carrying out specific restriction enzyme digestion linearization on the recombinant vector to expose a tail end homologous arm; and finally, under the exonuclease-mediated in-vitro annealing effect, cyclizing the linear DNA molecules through the homologous arms at the tail ends to complete DNA traceless modification. The traceless fixed-point transformation method can efficiently edit a biosynthetic pathway and perform traceless fixed-point modification such as DNA insertion, deletion and the like in a large polyketone gene cluster, so that a polyketone skeleton structure is purposefully changed or glycosyl modification is performed, and convenience is provided for modification of the biosynthetic pathway of a polyketone compound.

Description

technical field [0001] The invention relates to a traceless and fixed-point transformation method of a large gene cluster and an application thereof, belonging to the technical field of molecular biology. Background technique [0002] Reprogramming of biosynthetic pathways is an important way to enrich the structure of natural products. There are a large number of repetitive sequences in the biosynthetic gene cluster of polyketides, which makes it very difficult to modify genes without trace. Spinosyn (Spinosad) is a polyketide secondary metabolite isolated from Saccharopolyspora spinosa, and its main active components are spinosyn A and spinosyn D. Due to the broad-spectrum and high-efficiency insecticidal activity of spinosyn, unique insecticidal mechanism, excellent environmental safety and low mammalian toxicity, Dow AgroSciences has developed it into a variety of commercial green biopesticides . The biosynthesis of spinosad involves 23 genes, including 5 type I polyk...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/70C12N15/90C12N15/65C12N1/21C12R1/19
CPCC12N15/70C12N15/902C12N15/65C12N9/00C12N2800/80Y02A40/146
Inventor王海龙宋超逸栾霁符军张友明
OwnerSHANDONG UNIV