A kind of Bacillus multiple gene overlay knockout method

A Bacillus, multi-gene technology, applied in the field of microbial genetic engineering, can solve problems such as low efficiency, achieve the effects of improving efficiency, avoiding recovery, and improving the efficiency of transformation

Active Publication Date: 2019-05-07
WUHAN KANGFUDE BIOTECH CO LTD
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] The technical problem to be solved by the present invention is that the existing multi-gene knockout method is inefficient and will also leave screening marks in genomic DNA

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of Bacillus multiple gene overlay knockout method
  • A kind of Bacillus multiple gene overlay knockout method
  • A kind of Bacillus multiple gene overlay knockout method

Examples

Experimental program
Comparison scheme
Effect test

example 1

[0051] Example 1 Construction of thermosensitive knockout plasmid pKan194ts

[0052] 1. Use the pE194 plasmid as a template, and use primers F1 and R1 (see Table 1 for primers) to amplify the thermosensitive replicon 194ts fragment of the vector; the PCR system is: 10×PCRBuffer 5 μL, 2mM dNTPS 5 μL, 25mM MgSO 4 5 μL, 1.5 μL each of 10 μM primer F / R, 0.5 μL template DNA, 1 μL KOD-Plus-Neo, dH 2 O 32.5 μL; PCR reaction conditions are as follows: 94°C, 30 cycles (98°C for 10 s, 58°C for 30 s, 68°C for 1.5 min), 68°C for 5 min, and 4°C for incubation. In subsequent experiments, the PCR system and reaction conditions were configured and set according to the above conditions, the annealing temperature and extension time were adjusted according to the actual situation, and other parameters remained unchanged.

[0053] 2. Refer to the method in the CN201410430501.3 patent document to construct the pWEBK15 plasmid. The specific construction method is as follows:

[0054] Extract pET...

example 2

[0059] Example 2 Construction of thermosensitive knockout plasmid pCat194ts

[0060] 1. Use the pE194 plasmid as a template, and use primers F1 and R1 to amplify the thermosensitive replicon 194ts fragment of the vector.

[0061] 2. Refer to the method in CN201410430501.3 patent document to construct pWEBC26 plasmid. The build method is as follows:

[0062] Extract the pWEBK15 plasmid, digest it with EcoR V and Pci I, and recover a large fragment of about 1500bp with the DNA gel recovery kit. Using the genomic DNA of Bacillus licheniformis ATCC14580 as a template, using synthetic P9 (CGAGATATCATGAATTTTCAAACAATCGAGC) and P10 (CCCACATGTACAGAAAGTTTGTTGAGAGC) as primers to amplify the chloramphenicol resistance gene Cat, EcoR V and Pci I double enzyme digestion, PCR product purification kit purification Digested fragments. EcoR V and Pci I double-digested vector fragments and Cat gene fragments were ligated and transformed into Escherichia coli DH5α, spread on LB solid medium pla...

example 3

[0065] Example 3 Construction of thermosensitive knockout plasmid pTet194ts

[0066] Using the pHY300PLK plasmid as a template, the tetracycline resistance gene Tet was amplified with primers F4 and R4; using the plasmid pKan194ts as a template, the upstream and downstream primers F5 and R5 were used for PCR amplification of the whole plasmid, and the amplified product was digested with Dpn I overnight at 37°C After recovery, the carrier fragment and gene fragment were connected using the operation instructions of the seamless cloning kit, transformed into Escherichia coli JM110, coated on a 10 μg / ml tetracycline-resistant LB plate, and cultured at 30°C for 20 hours to screen clones. Primers R3 and P1 were verified by PCR and sequencing. The vector with successful sequencing was named pTet194ts. For the plasmid map, see Figure 4 .

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a multi-gene stacking knockout method for bacillus. The multi-gene stacking knockout method includes: inserting homologous arm gene segments of upstream and downstream of multiple genes to be knocked out of the bacillus into thermo-sensitive type plasmids to convert the bacillus, forcing homologous single-crossover to happen to knockout plasmids in the bacillus and genome DNA (deoxyribose nucleic acid) of the knockout plasmids through high-temperature culture, and screening double-crossover bacterial strains through high-temperature subculture; extracting the genome DNAs of the multiple bacterial strains successful in gene single-crossover, performing double-crossover screening, stacking the bacterial strains successful in knockout as host strains for the nest round of stacking knockout, and sequentially stacking to finally realize multi-gene knockout of the bacillus. Traceless gene knockout of the bacillus is realized with the thermo-sensitive type plasmids, conversion efficiency can be improved by using the single-crossover hose genome DNAs to convert the bacillus, restoration of the knockout genes in the host strains can be effectively avoided, and multi-gene stacking knockout efficiency is remarkably improved.

Description

technical field [0001] The invention relates to the field of microbial genetic engineering, in particular to a multi-gene overlay knockout method for bacillus. Background technique [0002] Bacillus (Bacillus) is a kind of aerobic or facultative anaerobic Gram-positive bacteria, which can produce stress-resistant endospores under certain conditions. And medical and other fields have important application value. Bacillus subtilis is a well-studied exogenous gene expression host in the genus Bacillus. However, due to the influence of many factors such as self-secreted protease, low transformation rate, and unstable expression plasmids, its application is limited. Bacillus also has this problem. [0003] Bacillus gene knockout technology is an important means to study gene function, and the use of this technology for molecular biology research is conducive to deepening the understanding of important metabolic and regulatory mechanisms of Bacillus organisms. Gene knockout (ge...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/75
CPCC12N15/75C12N2800/101
Inventor汪小锋汪卫张媛刘艳红印容叶聪
OwnerWUHAN KANGFUDE BIOTECH CO LTD