Application of stilbene glucosides in treating and preventing AIDS

A technology of stilbene glycosides and compounds, applied in medical preparations containing active ingredients, antiviral agents, organic active ingredients, etc., can solve the problem of HIV protease inhibition without related reports

Inactive Publication Date: 2013-06-19
TIANJIN INT JOINT ACADEMY OF BIOTECH & MEDICINE
View PDF8 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there is no relevant report on the inhibition of HIV protease by stilbene glycosides

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of stilbene glucosides in treating and preventing AIDS
  • Application of stilbene glucosides in treating and preventing AIDS
  • Application of stilbene glucosides in treating and preventing AIDS

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1HI

[0039] Expression, purification, protein activity detection and IC of embodiment 1 HIV-1 protease 50 Determination of value

[0040] (1) Amplification of HIV-1 protease fragment and construction of expression vector

[0041] Design primer PCR to amplify the HIV-1 protease coding fragment, recover the PCR product and pET-11a vector and digest it with Nde I and BamH I, recover the target fragment, connect the digested fragment with the linearized vector and transform E. coli.DH5α competent cells. The transformed clones were picked for PCR identification, and the positive clones were subjected to DNA sequencing.

[0042] Gene sequence of HIV-1 protease:

[0043] cctcagatcactctttggcaacgaccccctcgtcacaataaagataggggg

[0044] gcaactaaaggaagctctattagatacaggagcagatgatacagtattag

[0045] aagaaatgagtttgccaggaagatggaaaccaaaaatgatagggggaat

[0046] tggaggttttatcaaagtaagacagtatgatcagatactcatagaaatctg

[0047] cggacataaagctataggtacagtattaggtaggacctacacctgtcaacat

[0048] aattggaagaaa...

Embodiment 2

[0055] Example 2 Isolation of HIV-1 protease inhibitors from night-closed doors

[0056] 30 grams of 95% ethanol extract of Ye Shumen was dispersed with 1.4 times the amount of double-distilled water for 2 hours by ultrasonication, poured into a separatory funnel, extracted with petroleum ether, ethyl acetate and n-butanol in turn, fully shaken, Leave to stand for 6 hours, extract each solvent 3 times, separate the organic phase and the aqueous phase, and concentrate the extract with an EYELA N1001 rotary evaporator to obtain a dry paste that is extracted from petroleum ether, ethyl acetate and n-butanol. Screening and isolation of samples as HIV protease inhibitors in vitro.

[0057] The inhibitory effect of the extracts of the above three solvents on HIV protease was tested at a drug concentration of 0.5 mg / ml, and the inhibitory rates were found to be 39.81%, 92.71% and 97.86% respectively, and the n-butanol layer was removed by polyamide chromatography. The inhibition rat...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Inhibitory activityaaaaaaaaaa
Login to View More

Abstract

The invention provides an application of stilbene glucosides in preparing drugs for treating and preventing AIDS. Structural formulas of the stilbene glucosides are show as a general formula (I), wherein R1, R2, R3, R4, R5 or R6 independently represent hydrogen, hydroxyl, C1-C4 alkyl, C1-C4 alkoxy, C1-C4 acyloxy, halogen, nitryl, trifluoromethyl or a cyano group, and pre-conditions are that at least one of R1, R2 and R3 is the hydroxyl, at least one of R4, R5 and R6 is the hydroxyl, and at least one hydroxyl of R1, R2, R3, R4, R5 and R6 is connected with sugar. In the compounds represented by the general formula (I), an inhibitory activity (IC50) for the HIV-1 protease of 2,3,5,4-tetera-hydroxystilbene-2-O-beta-D-glucoside of the stilbene glucosides for reaches 126 [mu]M.

Description

technical field [0001] The invention relates to the field of medicinal chemistry, in particular to the application of stilbene glycosides. Background technique [0002] Acquired immunodeficiency syndrome (Acquired Immune Deficiency Syndrome, abbreviated as AIDS), also known as AIDS, is an infectious disease caused by human immunodeficiency virus (HIV). HIV virus is a virus that can attack the human immune system. It targets the most important T4 lymphocytes in the human immune system, engulfs and destroys T4 lymphocytes in large quantities, thereby destroying the human immune system and eventually causing the immune system to collapse. It makes the human body fall ill due to the loss of resistance to various diseases, resulting in various infections or tumors, and finally leads to death. [0003] The harm of AIDS has swept the world, and the spread is very rapid. In 1984, there were less than 3,000 reported AIDS patients worldwide. According to the "2008 AIDS Epidemic Rep...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K31/7034A61P31/18
Inventor饶子和杨诚李金楠张坛杰冯金磊唐延婷彭春娥陈卫强
OwnerTIANJIN INT JOINT ACADEMY OF BIOTECH & MEDICINE