Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Pharmaceutical applications of traditional Chinese medicine Cassia fistula L. fruit and extract thereof

A sausage bean and application technology, applied in the field of traditional Chinese medicine sausage bean and its extract, can solve the problems of no application of sausage bean, no final determination of anti-HIV active ingredients, etc.

Inactive Publication Date: 2013-06-19
TIANJIN INT JOINT ACADEMY OF BIOTECH & MEDICINE
View PDF7 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In addition, there is no application of sausage bean (Cassia fistula L.) in anti-AIDS drugs, and the above extracts have not been able to finally determine its anti-HIV active ingredients

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Pharmaceutical applications of traditional Chinese medicine Cassia fistula L. fruit and extract thereof
  • Pharmaceutical applications of traditional Chinese medicine Cassia fistula L. fruit and extract thereof
  • Pharmaceutical applications of traditional Chinese medicine Cassia fistula L. fruit and extract thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1 Chinese sausage bean original drug and preparation of extract

[0035] The traditional Chinese medicine sausage bean is taken as the original drug, crushed according to the conventional method, sieved to make sausage bean fine powder with a particle size of 60-80 mesh, sterilized, and packaged.

[0036] Weigh 2 kg of sausage bean fine powder, extract three times with 8 liters of 95% ethanol, reflux each time for 3 hours, combine organic phases, and extract 165 grams after concentration. spare.

Embodiment 2H

[0037] Expression, purification, protein activity detection and IC of embodiment 2 HIV-1 protease 50 Determination of value

[0038] 1) Expression and purification of HIV-1 protease:

[0039] a) Amplification of HIV-1 protease fragment and construction of expression vector

[0040] Design primer PCR to amplify the HIV-1 protease coding fragment, recover the PCR product and pET-11a vector and digest it with Nde I and BamH I, recover the target fragment, connect the digested fragment with the linearized vector and transform E. coli.DH5α competent cells. The transformed clones were picked for PCR identification, and the positive clones were subjected to DNA sequencing.

[0041] Gene sequence of HIV-1 protease:

[0042] cctcagatcactctttggcaacgaccccctcgtcacaataaagataggggg

[0043] gcaactaaaggaagctctattagatacaggagcagatgatacagtattag

[0044] aagaaatgagtttgccaggaagatggaaaccaaaaatgatagggggaat

[0045] tggaggttttatcaaagtaagacagtatgatcagatactcatagaaatctg

[0046] cggacataaagctata...

Embodiment 3

[0056] Example 3 Isolation of HIV-1 protease inhibitors from sausage beans

[0057] The extract obtained in Example 1 was used as a sample with 1.4 times the amount of double-distilled water to ultrasonically disperse it for 2 hours, pour it into a separatory funnel, extract it with ethyl acetate and n-butanol, shake it fully, and let it stand for 6 hour, each solvent was extracted 3 times, the organic phase and the aqueous phase were separated, and the extract was concentrated with an EYELAN1001 type rotary evaporator, and the obtained dry paste sausage bean ethyl acetate and n-butanol extracted samples were used as HIV protease inhibitors in vitro Screen and isolate samples.

[0058] The inhibitory effect of the above extracts on HIV protease was tested at a drug concentration of 0.5 mg / mL, and it was found that the ethyl acetate extract had better inhibitory activity, and the inhibitory rate was 83.4%. Therefore, the ethyl acetate extract was selected as the next separatio...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Granularityaaaaaaaaaa
Melting pointaaaaaaaaaa
Login to View More

Abstract

The invention provides an application of a traditional Chinese medicine Cassia fistula L. fruit in preparing medicines used for treating AIDS, and especially in preparing medicines used for inhibiting HIV-1 protease. A Cassia fistula L. fruit ethyl acetate extract provided by the invention has an HIV-1 protease activity inhibition rate of 83.4%. IC50 of HIV-1 protease inhibition activity of piceatannol separated from Cassia fistula L. fruit is 59mum.

Description

technical field [0001] The present invention relates to the use of traditional Chinese medicine, specifically, the invention relates to the use of traditional Chinese medicine sausage bean and its extract, belonging to the field of traditional Chinese medicine. Background technique [0002] AIDS (AIDS) is a chronic infectious disease caused by the human immunodeficiency virus (HIV). HIV mainly invades and destroys T4 lymphocytes, resulting in impairment of the body's cellular immune function, and eventually complicating various opportunistic infections and tumors. AIDS is a serious threat to the survival of human beings, which has attracted the attention of the World Health Organization and governments of various countries. AIDS is spreading more and more rapidly around the world, seriously threatening human health and social development, and has become the fourth biggest killer threatening people's health. UNAIDS announced on May 30, 2006 that since AIDS was first recogni...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K36/48A61P31/18
Inventor 陈卫强杨诚冯金磊张坛杰李金楠唐延婷郭宇
Owner TIANJIN INT JOINT ACADEMY OF BIOTECH & MEDICINE
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com