Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of HIP-55 protein to development of tumor inhibition drugs

A technology of HIP-55 and protein, which is applied in the direction of anti-tumor drugs, drug combinations, biological tests, etc., can solve the problem of no research on effects, and achieve the effects of inhibiting proliferation, promoting lung cancer cell invasion, and promoting apoptosis

Inactive Publication Date: 2014-05-07
PEKING UNIV THIRD HOSPITAL
View PDF3 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, its role in tumors has not been studied

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of HIP-55 protein to development of tumor inhibition drugs
  • Application of HIP-55 protein to development of tumor inhibition drugs
  • Application of HIP-55 protein to development of tumor inhibition drugs

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0046] Example 1, Construction of A549 cells overexpressing HIP-55 and A549 cells knocking down HIP-55

[0047] 1. Obtaining HIP-55siRNA

[0048] The following siRNA sequences were designed and synthesized for the human HIP-55 protein coding gene:

[0049] HIP-55 siRNA, the nucleotide sequence of which is 5'-GAUCCG CAGUGAACGUAGAGAAUUG UUCAAGAGACAAUUCUCUACGUUCACUGUU UUUUGGAAA-3' (SEQ ID NO: 3);

[0050] The nucleotide sequence of the control Scramble siRNA is 5'-GAUCCG CACUACCGGUUGUAUAGGUGUUCAAGAGA CACCUAUACAAAGGUAGUG UUUUGGAAA-3' (SEQ ID NO: 4).

[0051] 2. Construction of recombinant vectors for overexpressing HIP-55 and recombinant vectors for RNA interference HIP-55

[0052] 1. Construction of recombinant vector pLenti6 / V5-HIP-55 overexpressing HIP-55

[0053] Using the gene of HIP-55 shown in sequence 1 in the above sequence listing as a template, use

[0054] Forward: '-GGGGACAAGTTTGTACAAAAAAGCAGGCTTC ATGGCGGCGAACCTGAGCC-3' and

[0055] Reverse: 5'-GGGGACCACTTTGTACAA...

Embodiment 2

[0079] Example 2, Functional Research of HIP-55

[0080] 1. Effect of HIP-55 on the proliferation and apoptosis of A549 cells

[0081] 1. The effect of HIP-55 on the proliferation of lung cancer A549 cells

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses application of HIP-55 protein to development of tumor inhibition drugs. DNA molecules encoding and interfering HIP-55 protein from expressing siRNA are inserted into an expression vector to obtain a recombinant vector; the amino acid sequence of the HIP-55 protein is a sequence II in a sequence table; the invention also provides application of HIP-55 protein or the recombinant vector containing the HIP-55 protein coding gene to preparation of products having the following functions of (1) promoting tumor cell migration and / or (2) promoting tumor cell invasion. Experiments prove that the HIP-55 protein gene is overexpressed in lung cancer cells to promote tumor formation, lung cancer cell migration and lung cancer cell invasion; therefore, the HIP-55 provides a new target for clinical diagnosis, treatment and development of new drugs and can be used for screening, developing and / or designing products for prevention and / or treatment of tumors.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to the application of a HIP-55 protein in the development of antitumor drugs. Background technique [0002] HIP-55 (hematopoietic progenitor kinase 1 [HPK1]-interacting protein of 55kDa; also known as drebrin-like protein DBNL, mAbp1 or SH3P7) is a protein containing a multifunctional domain. Its structure mainly includes the N-terminal F-actin protein binding domain and the C-terminal SH3 domain. HIP-55 is involved in synaptogenesis, receptor endocytosis, cytoskeleton rearrangement and signal transduction. At present, the function of HIP-55 is poorly understood. It is known that HIP-55 plays an important role in the immune system by regulating T cell receptor endocytosis, cytokine release and B cell receptor presentation. Recent studies have shown that HIP-55 regulates cytoskeletal rearrangements in the nervous system by interacting with N-WASP and Arp2 / 3. However, its role in tumor...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/85A61K48/00A61P35/00G01N33/68
Inventor 李子健付海安石智李增刚
Owner PEKING UNIV THIRD HOSPITAL
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More