Sex- and tissue-specific expression of exogenous genes and methods using silkworm vitellogenin promoter
A technology of vitellogenin and exogenous genes, applied in the field of sex-specific and tissue-specific expression of exogenous genes
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0096] Example 1. Construction of the vector
[0097] The PXL-BacII-IE1-DsRed2 injection transposon vector utilized in the present invention is derived from piggyBac (see Elick et al., Genetica, 1996; WO 2006122442), and the IE1 promoter (Kojima et al. , Virus Research, 2008) driven red fluorescent protein DsRed (NCBI accession number: AJ851284; SEQ ID NO: 2), construct PXL-BacII-IE1-DsRed2 transgenic vector. The silkworm Vgp promoter sequence was obtained from the upstream 800bp sequence of the Vg protein by segmented total gene synthesis, and cloned into the vector PUC-57 (Sangon Biotech). Using specific primers VgF (CGGGGTACCCCGCCCGATCCATTAACA GTGCT, SEQ ID NO: 3) and VgR (AAGGGCCCTTGGATCTGAACATCTCTGGCC, SEQ ID NO: 4) containing KpnI and ApaI, high-fidelity enzyme KOD (Genview) was used for PCR amplification from vector plasmid PUC-57-vgp. and cloned into pMD-18T (TaKaRa) to construct plasmid pMD-18T-Vgp. After the sequencing was correct, pMD-18T-Vgp and PXL-BacII-IE1-DsRe...
Embodiment 2
[0098] Example 2. Detection of BmN cell level
[0099] Transform the three constructed plasmids into silkworm ovary cells (BmN cells, see EP0225777) respectively. If the Vgp promoter is active and has tissue-specificity and sex-specificity as predicted, that is, only in a certain sex If it is expressed in a specific organ, green fluorescence will be observed in the experiment. The method of cell transfection used in the experiment refers to the Effectene Transfection Reagent kit produced by Qiagen. The method is briefly as follows: take a 24-well plate, select 12 wells, add 300ul of BmN cells to each well, and culture overnight. The transfection plasmids PXL-BacII-IE1-DsRed2-EGFP, PXL-BacII-IE1-DsRed2-VgpEGFP, PXL-BacII-IE1-DsRed2-Vgp were purified and prepared, and the concentration was diluted to 200ng / ul. Perform the following operations in the ultra-clean bench: take 70ul of EC and add it to a 1.5ml EP tube; then take 7.5ul of plasmid and mix it; add 12ul of Enhance, mix ...
Embodiment 3
[0102] Example 3. Obtaining of transgenic silkworm and detection of specific expression of promoter
[0103] In this example, three plasmids containing only a reporter gene, a promoter and a reporter gene, and a promoter only, namely, PXL-BacII-IE1-DsRed2-EGFP, PXL-BacII-IE1-DsRed2-Vgp-EGFP , PXL-BacII-IE1-DsRed2-Vgp were mixed with PHA3PIG (Tamura et al., Nature Biotechnology, 2000, also refer to EP1482035; used as an auxiliary plasmid to produce transposase) and injected into silkworm primipara (laying After 4-8 hours), the injection plasmid DNA purification kit was purified with Qiagen's Plasmid Midi kit, and the injection method was microinjected into silkworms according to the method described by Kanda & Tamura (1991). The injected silkworm eggs are sealed with non-toxic glue to prevent contamination. Under the condition of 25 ℃, the greening is carried out until hatching, and the hatched silkworms are raised, and the contemporary (G0) silkworm moths are selfed to obtain...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com