Unlock instant, AI-driven research and patent intelligence for your innovation.

Sex- and tissue-specific expression of exogenous genes and methods using silkworm vitellogenin promoter

A technology of vitellogenin and exogenous genes, applied in the field of sex-specific and tissue-specific expression of exogenous genes

Active Publication Date: 2016-09-07
CAS CENT FOR EXCELLENCE IN MOLECULAR PLANT SCI
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there is no related promoter reported in silkworm

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Sex- and tissue-specific expression of exogenous genes and methods using silkworm vitellogenin promoter
  • Sex- and tissue-specific expression of exogenous genes and methods using silkworm vitellogenin promoter
  • Sex- and tissue-specific expression of exogenous genes and methods using silkworm vitellogenin promoter

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0096] Example 1. Construction of the vector

[0097] The PXL-BacII-IE1-DsRed2 injection transposon vector utilized in the present invention is derived from piggyBac (see Elick et al., Genetica, 1996; WO 2006122442), and the IE1 promoter (Kojima et al. , Virus Research, 2008) driven red fluorescent protein DsRed (NCBI accession number: AJ851284; SEQ ID NO: 2), construct PXL-BacII-IE1-DsRed2 transgenic vector. The silkworm Vgp promoter sequence was obtained from the upstream 800bp sequence of the Vg protein by segmented total gene synthesis, and cloned into the vector PUC-57 (Sangon Biotech). Using specific primers VgF (CGGGGTACCCCGCCCGATCCATTAACA GTGCT, SEQ ID NO: 3) and VgR (AAGGGCCCTTGGATCTGAACATCTCTGGCC, SEQ ID NO: 4) containing KpnI and ApaI, high-fidelity enzyme KOD (Genview) was used for PCR amplification from vector plasmid PUC-57-vgp. and cloned into pMD-18T (TaKaRa) to construct plasmid pMD-18T-Vgp. After the sequencing was correct, pMD-18T-Vgp and PXL-BacII-IE1-DsRe...

Embodiment 2

[0098] Example 2. Detection of BmN cell level

[0099] Transform the three constructed plasmids into silkworm ovary cells (BmN cells, see EP0225777) respectively. If the Vgp promoter is active and has tissue-specificity and sex-specificity as predicted, that is, only in a certain sex If it is expressed in a specific organ, green fluorescence will be observed in the experiment. The method of cell transfection used in the experiment refers to the Effectene Transfection Reagent kit produced by Qiagen. The method is briefly as follows: take a 24-well plate, select 12 wells, add 300ul of BmN cells to each well, and culture overnight. The transfection plasmids PXL-BacII-IE1-DsRed2-EGFP, PXL-BacII-IE1-DsRed2-VgpEGFP, PXL-BacII-IE1-DsRed2-Vgp were purified and prepared, and the concentration was diluted to 200ng / ul. Perform the following operations in the ultra-clean bench: take 70ul of EC and add it to a 1.5ml EP tube; then take 7.5ul of plasmid and mix it; add 12ul of Enhance, mix ...

Embodiment 3

[0102] Example 3. Obtaining of transgenic silkworm and detection of specific expression of promoter

[0103] In this example, three plasmids containing only a reporter gene, a promoter and a reporter gene, and a promoter only, namely, PXL-BacII-IE1-DsRed2-EGFP, PXL-BacII-IE1-DsRed2-Vgp-EGFP , PXL-BacII-IE1-DsRed2-Vgp were mixed with PHA3PIG (Tamura et al., Nature Biotechnology, 2000, also refer to EP1482035; used as an auxiliary plasmid to produce transposase) and injected into silkworm primipara (laying After 4-8 hours), the injection plasmid DNA purification kit was purified with Qiagen's Plasmid Midi kit, and the injection method was microinjected into silkworms according to the method described by Kanda & Tamura (1991). The injected silkworm eggs are sealed with non-toxic glue to prevent contamination. Under the condition of 25 ℃, the greening is carried out until hatching, and the hatched silkworms are raised, and the contemporary (G0) silkworm moths are selfed to obtain...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an application and a method utilizing a bombyx mori linnaeus vitellogenin promoter for gender-specific and tissue-specific expression of an exogenous gene. The method breaks through a limitation that a traditional transgenic bombyx mori linnaeus cannot effectively perform male-specific, female-specific and tissue-specific expression of the exogenous gene, and develops and utilizes the bombyx mori linnaeus vitellogenin promoter for gender-specific and tissue-specific expression of the exogenous gene in bombyx mori linnaeus cell lines and the transgenic bombyx mori linnaeus for the first time. Therefore, with the first time of utilization of gender expression controllability and tissue expression controllability of the transgenic bombyx mori linnaeus, the application field of the bombyx mori linnaeus is expanded, the sustainable development of sericulture is maintained, and genetic control of insect pests can be studied.

Description

technical field [0001] The present invention relates to the field of biotechnology. Specifically, the present invention relates to a sex-specific and tissue-specific expression method and application of a foreign gene by using the vitellogenin (Vg) promoter of the silkworm (Bombyx mori Linnaeus). Background technique [0002] Bombyx mori is a silk insect, and it is also an important economic insect and model organism in Lepidoptera. It has made great contributions to my country's economic development and is making greater contributions to China's sustainable economic development. As my country's silkworm genome project announced the completion of the silkworm genome framework, it marked the arrival of the silkworm post-genome era. The main work of functional genomics includes: the cloning and identification of a large number of functional genes, the molecular regulation mechanism of important biological traits, and the realization of artificial Control and regulate these gen...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/113C12N15/63C12N5/10C12N15/85A01K67/033A01K67/04
Inventor 谭安江许军尤朗黄勇平
Owner CAS CENT FOR EXCELLENCE IN MOLECULAR PLANT SCI