A nematode apoptosis regulation gene ced-4 inducible promoter, rice expression vector and preparation method thereof
A technology for expression vector and gene regulation, applied in the direction of using vector to introduce foreign genetic material, DNA/RNA fragments, recombinant DNA technology, etc., can solve the problem that expression vector has not been reported yet.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] The wn-2 promoter sequence is as SEQ ID NO. 1;
[0035] The promoter wn-2 and P35S (SEQ ID NO.7) were cloned into the pCAMBIA1305.1 vector (wn-2 is located in front of P35S) to obtain the intermediate vector pCA-Wn-2. The primers for amplifying the Wn-2-P35S fusion product are as follows:
[0036] Wn-2-P35S-FP:
[0037] AAAGAATTC-TTCTAGCCACCAGATTTGACCAAACCATCAACTCATCTGTATATAATATGGAGTCAAAGATTCAAATAGAGGACC (SEQ IDNO.3);
[0038] Wn-2-P35S-RP:
[0039] AAAACTAGTCTGCAGAGTCCCCCGTGTTCTCTCCA (SEQIDNO.4);
[0040] The specific process is: insert EcoRI and SpeI (before the p35S promoter and the front part of GUS) into the pCAMBIA1305.1 vector through EcoRI and SpeI sites to obtain the intermediate vector pCA-Wn-2;
[0041] The target gene ced-4 was cloned into the pCA-Wn-2 vector (via the PstI and PmlI sites) to obtain the rice expression vector, which was named pCA-wn-2-CED-4 expression vector, pCA-wn-2 -The sequence of the CED-4 expression vector is shown in SEQ ID NO. 2;
[0042] The pri...
Embodiment 2
[0047] Example 2 Verification of Rice Expression Vector
[0048] The constructed rice expression vector, through various treatments, experimental design and induction, experimental steps and results are as follows:
[0049] (1) Transgenic rice seedlings were inoculated with Hirschsprung's root nematode.
[0050] (2) To detect the apoptosis and allergic reaction phenotypes of rice root epidermal cells, see the statistical table of staining test results.
[0051] (3) For the detection of CED-4 protein expressed by the transgenic target gene, see the attached drawings in the instruction manual.
[0052] Dyeing method for measuring allergic reaction of rice root cells:
[0053] The roots of rice were dyed separately for 15 minutes and rinsed with running water to remove unbound dyes. The dyes bound to dead cells were extracted with a solution containing 50% methanol and 1% SDS at 50°C for 30 minutes, and the light absorption value of the extract was measured. The measurement wavelength of p...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 