Supercharge Your Innovation With Domain-Expert AI Agents!

A nematode apoptosis regulation gene ced-4 inducible promoter, rice expression vector and preparation method thereof

A technology for expression vector and gene regulation, applied in the direction of using vector to introduce foreign genetic material, DNA/RNA fragments, recombinant DNA technology, etc., can solve the problem that expression vector has not been reported yet.

Active Publication Date: 2016-05-18
YICHUN UNIVERSITY
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The inducible promoter W-box has been studied in dicotyledonous plants such as tobacco and successfully induced expression in pathogen infection, but it has not been reported to induce the expression vector of the target gene ced-4 in rice

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A nematode apoptosis regulation gene ced-4 inducible promoter, rice expression vector and preparation method thereof
  • A nematode apoptosis regulation gene ced-4 inducible promoter, rice expression vector and preparation method thereof
  • A nematode apoptosis regulation gene ced-4 inducible promoter, rice expression vector and preparation method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] The wn-2 promoter sequence is as SEQ ID NO. 1;

[0035] The promoter wn-2 and P35S (SEQ ID NO.7) were cloned into the pCAMBIA1305.1 vector (wn-2 is located in front of P35S) to obtain the intermediate vector pCA-Wn-2. The primers for amplifying the Wn-2-P35S fusion product are as follows:

[0036] Wn-2-P35S-FP:

[0037] AAAGAATTC-TTCTAGCCACCAGATTTGACCAAACCATCAACTCATCTGTATATAATATGGAGTCAAAGATTCAAATAGAGGACC (SEQ IDNO.3);

[0038] Wn-2-P35S-RP:

[0039] AAAACTAGTCTGCAGAGTCCCCCGTGTTCTCTCCA (SEQIDNO.4);

[0040] The specific process is: insert EcoRI and SpeI (before the p35S promoter and the front part of GUS) into the pCAMBIA1305.1 vector through EcoRI and SpeI sites to obtain the intermediate vector pCA-Wn-2;

[0041] The target gene ced-4 was cloned into the pCA-Wn-2 vector (via the PstI and PmlI sites) to obtain the rice expression vector, which was named pCA-wn-2-CED-4 expression vector, pCA-wn-2 -The sequence of the CED-4 expression vector is shown in SEQ ID NO. 2;

[0042] The pri...

Embodiment 2

[0047] Example 2 Verification of Rice Expression Vector

[0048] The constructed rice expression vector, through various treatments, experimental design and induction, experimental steps and results are as follows:

[0049] (1) Transgenic rice seedlings were inoculated with Hirschsprung's root nematode.

[0050] (2) To detect the apoptosis and allergic reaction phenotypes of rice root epidermal cells, see the statistical table of staining test results.

[0051] (3) For the detection of CED-4 protein expressed by the transgenic target gene, see the attached drawings in the instruction manual.

[0052] Dyeing method for measuring allergic reaction of rice root cells:

[0053] The roots of rice were dyed separately for 15 minutes and rinsed with running water to remove unbound dyes. The dyes bound to dead cells were extracted with a solution containing 50% methanol and 1% SDS at 50°C for 30 minutes, and the light absorption value of the extract was measured. The measurement wavelength of p...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a nematode apoptosis regulatory gene ced-4 inducible promoter wn-2, a rice expression vector pCA-Wn-2-CED-4 and a preparation method of the pCA-Wn-2-CED-4 expression vector. According to the invention, a TATA-box core sequence shared by animal and plant genes is added into the reported core sequence having the best inductive effect in a W-box series of the promoter, therefore, a novel wn-2 sequence of a nematode apoptosis gene in rice expression is innovatively designed; the wn-2 and the inherent promoter of the rice expression vector are fused, so that the novel pCA-Wn-2-CED-4 expression vector of the rice expression vector is constructed; the pCA-Wn-2-CED-4 expression vector has the superior effect of inducing rice expression of the target gene ced-4; and the pCA-Wn-2-CED-4 expression vector is screened and connected to correct vector clone and successfully converted into rice varieties, such as Nipponbare and Lijiang Xintuan dark rice.

Description

Technical field [0001] The application belongs to the field of biotechnology, and specifically relates to a nematode apoptosis regulating gene ced-4 induction promoter, a rice expression vector and a preparation method thereof. Background technique [0002] Since the nematode cell apoptosis regulatory gene ced-4 does not exist in rice, whether the ced-4 gene can be successfully activated in rice and successfully express the target protein is crucial to the scientific design of the promoter; that is, the animal genes are in plants For expression, the problem of compatibility between promoter nematodes and rice must be solved, and pathogen infection must be induced to initiate gene expression. This is the technical goal of this patent. [0003] According to the latest relevant research literature at home and abroad, there are no detailed reports on the promoter and expression vector of monocot rice induced by pathogen infection. [0004] The inducible promoter W-box has been studied i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/113C12N15/82C12N15/66
Inventor 邹一平韩成云
Owner YICHUN UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com