Unlock instant, AI-driven research and patent intelligence for your innovation.
A method for detecting bisphenol A concentration in a sample
What is Al technical title?
Al technical title is built by PatSnap Al team. It summarizes the technical point description of the patent document.
A technology for detecting samples and concentrations, applied in the field of chemistry, can solve the problems of inconvenient detection and high cost, and achieve the effect of improving efficiency and sensitivity
Active Publication Date: 2016-12-07
HUAWEI TEHCHNOLOGIES CO LTD
View PDF7 Cites 0 Cited by
Summary
Abstract
Description
Claims
Application Information
AI Technical Summary
This helps you quickly interpret patents by identifying the three key elements:
Problems solved by technology
Method used
Benefits of technology
Problems solved by technology
[0005] The purpose of the present invention is to provide a method for detecting the concentration of bisphenol A in a sample, so as to overcome the problems of inconvenient detection and high cost of existing methods for detecting bisphenol A
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more
Image
Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
Click on the blue label to locate the original text in one second.
Reading with bidirectional positioning of images and text.
Smart Image
Examples
Experimental program
Comparison scheme
Effect test
Embodiment 1
[0024] Example 1 Design and synthesis of corresponding DNA fragments.
[0025] Design a DNA fragment that can specifically bind to BPA molecules, and perform fluorescent modification with carboxyfluorescein FAM at the 5' end. DNA sequences were prepared by a DNA synthesizer.
[0026] Fluorescence-modified DNA: 5’-FAM–CCGGTGGGTGGTCAGGTGGGATAGCGTTCCGCGTATGGCCCAGCGCATCACGGGTTCGCACCA–3 ， (SEQ ID NO: 1).
Embodiment 2
[0027] Example 2 Experimental determination of the optimum concentration of graphene oxide.
[0028] Take 7 centrifuge tubes, respectively add 2 μL of 100 μM fluorescence-modified DNA (final concentration: 100 nM), 1 mg / mL graphene oxide (final concentration: 20, 40, 60, 80, 100, 120, 150 μg / mL) ). Then add 0.02M-Tris-HCl buffer (containing 0.01% SDS, MgCl 2 20mM, KCl 40mM, NaCl 100mM, pH8.0) to a volume of 2mL. The fluorescence intensity was measured respectively, and then 4 μL of 50 μg / mL BPA was added to each centrifuge tube, and the final concentration of BPA was 100 ng / ml. React for 20 minutes, then measure the fluorescence intensity, compare the changes before and after, and select the optimal concentration of graphene oxide to be 100 μg / mL, that is, the optimal concentration of graphene oxide used in our experiment is 100 μg / mL.
Embodiment 3
[0029] Example 3 Establishment of BPA standard curve.
[0030] Take 9 centrifuge tubes, add 2 μL of 100 μM fluorescence-modified DNA (final concentration: 100 nM), and 1 mg / mL graphene oxide (final concentration: 100 μg / mL) in sequence. Then add 0.02M Tris-HCl buffer (pH 8.0) to each centrifuge tube to a volume of 2 mL. Measure the fluorescence intensity in turn, and then add different amounts of BPA solution to the 10 centrifuge tubes sequentially (final concentrations are 0, 0.02, 0.05, 0.2, 0.8, 2, 10, 50, 100 ng / ml) to react for 20 Minutes later, measure the fluorescence intensity in turn, compare the fluorescence intensity before and after, and make a standard curve of BPA. The linear range of this method is 0.02-10 ng / ml, and the detection limit is 0.01 ng / ml. The linear equation of the standard curve is y=0.0836x+0.6941, and y is (F-F 0 ) / F 0 , x is the concentration of the corresponding BPA, linear correlation>0.99.
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
PUM
Property
Measurement
Unit
concentration
aaaaa
aaaaa
concentration
aaaaa
aaaaa
concentration
aaaaa
aaaaa
Login to View More
Abstract
The invention relates to a method for detecting the concentration of bisphenol A in a sample. The method comprises the following steps of (1) mixing oxidized graphene and a DNA (deoxyribonucleic acid) fragment which can be specifically combined with bisphenol A, wherein the end 5' of the DNA fragment is decorated by fluorescence, so that the fluorescence marked on the DNA fragment can be quenched; (2) mixing a sample to be detected with the mixture, desorbing the DNA fragment in the presence of bisphenol A, and restoring the fluorescence marked on the DNA fragment; and (3) determining the concentration of bisphenol A in the sample according to the restoration degree of the fluorescence in the step (2). According to the method, a brand new biological sensor which is simple, rapid, high in selectivity and high in sensitivity and used for detecting the concentration of the bisphenol A in the sample can be provided.
Description
technical field [0001] The invention belongs to the field of chemistry and relates to a method for detecting the concentration of bisphenol A in a sample. Background technique [0002] Nanomaterials have unique physical and chemical properties, and their application in biosensors has become an international research frontier and research hotspot. The combination of nanomaterials and biosensors involves nanotechnology, information technology, biotechnology and other disciplines, and has an important impact on clinical monitoring, environmental monitoring and other fields. As one of the most important nanomaterials, carbon nanomaterials have potential advantages, which make them have broad application prospects in the fields of chemistry, physics and materials science. [0003] Bisphenol A (BPA) is an estrogen-like chemical that triggers a hormonal response in the body. It is an organic compound containing two phenolic functional groups. It is a raw material and additive for...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
Application Information
Patent Timeline
Application Date:The date an application was filed.
Publication Date:The date a patent or application was officially published.
First Publication Date:The earliest publication date of a patent with the same application number.
Issue Date:Publication date of the patent grant document.
PCT Entry Date:The Entry date of PCT National Phase.
Estimated Expiry Date:The statutory expiry date of a patent right according to the Patent Law, and it is the longest term of protection that the patent right can achieve without the termination of the patent right due to other reasons(Term extension factor has been taken into account ).
Invalid Date:Actual expiry date is based on effective date or publication date of legal transaction data of invalid patent.
Login to View More