Unlock instant, AI-driven research and patent intelligence for your innovation.

Unicellular self-suspended growing MDCK (Madin-Darby canine kidney) cell strain capable of stably expressing TMPRSS2 (Transmembrane Protease Serines) protein as well as construction method and application thereof

A stable expression, single-cell technology, applied in the cultivation of avian influenza virus, single-cell self-suspension growth MDCK cell line, single-cell self-suspension growth MDCK cell line field

Active Publication Date: 2014-07-23
JIANGSU ACAD OF AGRI SCI
View PDF0 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] However, the effect of adding exogenous protease on the growth state of host cells is irreversible, especially the effect of protease accumulation after continuous passage of seed virus on the physiological state of host cells Extremely serious, thereby affecting the proliferation efficiency of avian influenza virus

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Unicellular self-suspended growing MDCK (Madin-Darby canine kidney) cell strain capable of stably expressing TMPRSS2 (Transmembrane Protease Serines) protein as well as construction method and application thereof
  • Unicellular self-suspended growing MDCK (Madin-Darby canine kidney) cell strain capable of stably expressing TMPRSS2 (Transmembrane Protease Serines) protein as well as construction method and application thereof
  • Unicellular self-suspended growing MDCK (Madin-Darby canine kidney) cell strain capable of stably expressing TMPRSS2 (Transmembrane Protease Serines) protein as well as construction method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0061] Example 1 Construction of pIRES-TMPRSS2 expression vector

[0062] 1.1 Reagent

[0063] The plasmid vector containing the ORF of human TMPRSS2 protein was purchased from Beijing Yiqiao Shenzhou Biotechnology Co., Ltd. (Cat. No.: HG13070-G). Trizol, MMLV reverse transcription system, pMD19-T vector, oligo dT, various restriction endonucleases, ExTaq enzyme, T4DNA ligase and other molecular biology materials were purchased from TAKARA Company, and pIRES plasmid was purchased from National Veterinary Biological Products Engineering Technology The research center is preserved. The gel recovery kit and the plasmid small and large extraction kit were all purchased from Qiagen.

[0064] 1.2 Primer synthesis: The primers used to amplify the ORF sequence of human TMPRSS2 protein were synthesized by Shanghai Shenggong.

[0065] p1: GCC GCTAGC TAATACGACTCACTATAGGG (the underlined is the Nhe I restriction site)

[0066] p2: GCC TCTAGA TAGAAGGCACAGTCGAGG (the underlined is the Xba...

Embodiment 2

[0074] Example 2 Construction and screening of recombinant MDCK-Sus-TMPRSS2 recombinant cell clone

[0075] 2.1 Material:

[0076] Reagents: DMEM, G418, Opti-MEM, PEI (25kD linear) reagents were purchased from Invitrogen. The rabbit anti-human TMPRSS2 protein primary antibody was purchased from Santa Cruz Biotechnology Company, and FITC-labeled goat anti-rabbit IgG and HRP-labeled goat anti-rabbit IgG were purchased from Hangzhou Lianke Biotechnology Company. Trizol, MMLV reverse transcription system, oligo dT, ExTaq enzyme and other molecular biology reagents were purchased from TAKARA.

[0077] Biological materials: MDCK-Sus cell line was domesticated and expanded by the National Veterinary Biological Products Engineering Technology Research Center. The medium for self-suspension growth of single cells of this cell line was developed by the National Veterinary Biological Products Engineering Technology Research Center. Prepared, use DMEM / F12 (1:1) medium as the basic medium, ...

Embodiment 3

[0106] Example 3 Determination of the suspension culture performance of the recombinant MDCK-Sus-TMPRSS2 cell line

[0107] 3.1 Materials and methods

[0108] The female MDCK-Sus cells are preserved by the Domestication and Establishment Department of the National Veterinary Biological Products Engineering Technology Research Center.

[0109] The recombinant MDCK-Sus-TMPRSS2 cell line was screened and obtained as described above and established.

[0110] The medium for suspension growth is as described above.

[0111] MDCK-Sus cells and recombinant MDCK-Sus-TMPRSS2 cells are 3×10 5 The initial density of cells / ml is inoculated in a 250ml culture shake flask and placed at 37℃, 5% CO 2 , Suspension culture is carried out in a culture shaker with a rotation speed of 180 rpm. Sampling every 24 hours to determine the cell density and survival rate, draw a growth curve, and calculate the specific cell growth rate.

[0112] In a 3L bioreactor (product of Applikon, the Netherlands), MD...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a unicellular self-suspended growing MDCK (Madin-Darby canine kidney) cell strain capable of stably expressing a TMPRSS2 (Transmembrane Protease Serines) protein as well as a construction method and application thereof in culture of an avian influenza virus. The invention belongs to the bio-technical field and discloses the unicellular self-suspended growing MDCK cell strain capable of stably expressing the TMPRSS2 protein, wherein the cell strain is named MDCK-Sus-TMPRSS2 and is preserved in China General Microbiological Culture Collection Center with the preservation number of CGMCCNo.8851. At the same time, the invention provides the construction method of the cell strain and an application mode of the cell strain in culture of the avian influenza virus. Therefore, trypsin treated with TPCK (Tosyl-Phenylalanine Chloromethyl-Ketone) is not added for culturing the avian influenza virus so as to effectively solve the irreversible influence of an exogenous protease to growth of a host cell and remarkably improve the proliferation efficiency of the avian influenza virus.

Description

[0001] technical field [0002] The present invention relates to a single-cell self-suspension growth MDCK cell strain and its application, in particular to a single-cell self-suspension growth MDCK cell strain capable of stably expressing human TMPRSS2 protein, its construction method and its application in cultivating avian influenza virus . The invention belongs to the field of biotechnology. [0003] Background technique [0004] At present, the use of continuous passage cell lines instead of SPF chicken embryos in bioreactors for large-scale proliferation and preparation of avian influenza viruses is a research hotspot that scientific research institutes or veterinary vaccine manufacturers are competing to carry out. [0005] The prerequisite for the HA protein on the surface of the avian influenza virus particle to bind to the virus receptor on the host cell is that the HA protein is effectively cleaved at its basic amino acid (Lys or Arg) site to form HA1 protein ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N5/10C12N15/63C12N15/01C12N7/01
Inventor 冯磊吴培培褚轩王伟峰华涛陈丽侯继波
Owner JIANGSU ACAD OF AGRI SCI