Unicellular self-suspended growing MDCK (Madin-Darby canine kidney) cell strain capable of stably expressing TMPRSS2 (Transmembrane Protease Serines) protein as well as construction method and application thereof
A stable expression, single-cell technology, applied in the cultivation of avian influenza virus, single-cell self-suspension growth MDCK cell line, single-cell self-suspension growth MDCK cell line field
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0061] Example 1 Construction of pIRES-TMPRSS2 expression vector
[0062] 1.1 Reagent
[0063] The plasmid vector containing the ORF of human TMPRSS2 protein was purchased from Beijing Yiqiao Shenzhou Biotechnology Co., Ltd. (Cat. No.: HG13070-G). Trizol, MMLV reverse transcription system, pMD19-T vector, oligo dT, various restriction endonucleases, ExTaq enzyme, T4DNA ligase and other molecular biology materials were purchased from TAKARA Company, and pIRES plasmid was purchased from National Veterinary Biological Products Engineering Technology The research center is preserved. The gel recovery kit and the plasmid small and large extraction kit were all purchased from Qiagen.
[0064] 1.2 Primer synthesis: The primers used to amplify the ORF sequence of human TMPRSS2 protein were synthesized by Shanghai Shenggong.
[0065] p1: GCC GCTAGC TAATACGACTCACTATAGGG (the underlined is the Nhe I restriction site)
[0066] p2: GCC TCTAGA TAGAAGGCACAGTCGAGG (the underlined is the Xba...
Embodiment 2
[0074] Example 2 Construction and screening of recombinant MDCK-Sus-TMPRSS2 recombinant cell clone
[0075] 2.1 Material:
[0076] Reagents: DMEM, G418, Opti-MEM, PEI (25kD linear) reagents were purchased from Invitrogen. The rabbit anti-human TMPRSS2 protein primary antibody was purchased from Santa Cruz Biotechnology Company, and FITC-labeled goat anti-rabbit IgG and HRP-labeled goat anti-rabbit IgG were purchased from Hangzhou Lianke Biotechnology Company. Trizol, MMLV reverse transcription system, oligo dT, ExTaq enzyme and other molecular biology reagents were purchased from TAKARA.
[0077] Biological materials: MDCK-Sus cell line was domesticated and expanded by the National Veterinary Biological Products Engineering Technology Research Center. The medium for self-suspension growth of single cells of this cell line was developed by the National Veterinary Biological Products Engineering Technology Research Center. Prepared, use DMEM / F12 (1:1) medium as the basic medium, ...
Embodiment 3
[0106] Example 3 Determination of the suspension culture performance of the recombinant MDCK-Sus-TMPRSS2 cell line
[0107] 3.1 Materials and methods
[0108] The female MDCK-Sus cells are preserved by the Domestication and Establishment Department of the National Veterinary Biological Products Engineering Technology Research Center.
[0109] The recombinant MDCK-Sus-TMPRSS2 cell line was screened and obtained as described above and established.
[0110] The medium for suspension growth is as described above.
[0111] MDCK-Sus cells and recombinant MDCK-Sus-TMPRSS2 cells are 3×10 5 The initial density of cells / ml is inoculated in a 250ml culture shake flask and placed at 37℃, 5% CO 2 , Suspension culture is carried out in a culture shaker with a rotation speed of 180 rpm. Sampling every 24 hours to determine the cell density and survival rate, draw a growth curve, and calculate the specific cell growth rate.
[0112] In a 3L bioreactor (product of Applikon, the Netherlands), MD...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 