Application of pca3, cst1 and cst4 in preparation of prostate cancer markers and kit thereof

A prostate cancer and kit technology, applied in the field of diagnosis, can solve the problems of prostate cancer diagnosis prediction, efficacy evaluation, metastasis and recurrence monitoring that have not been reported, and achieve the effects of reducing sampling pain, good specificity, and convenient use.

Active Publication Date: 2015-07-29
SHANGHAI LIANGRUN BIOMEDICINE TECH CO LTD
View PDF3 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

But so far, there is no report that CST1 and CST4 can be used for diagnosis and prediction, efficacy evaluation, metastasis and recurrence monitoring of prostate cancer

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of pca3, cst1 and cst4 in preparation of prostate cancer markers and kit thereof
  • Application of pca3, cst1 and cst4 in preparation of prostate cancer markers and kit thereof
  • Application of pca3, cst1 and cst4 in preparation of prostate cancer markers and kit thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Embodiment 1, magnetic bead method specifically enriches the mRNA of PCA3, CST1, CST4 and PSA gene from urine

[0030]According to the mRNA sequence design of PCA3, CST1, CST4 and PSA, the specific probe (the nucleotide sequence of PCA3mRNA is shown in SEQ ID NO.1, the nucleotide sequence of CST1mRNA is shown in the mRNA of PCA3, CST1, CST4 and SDHA gene) Shown in SEQ ID NO.2, the nucleotide sequence of CST4mRNA is as SEQ ID NO.3, and the nucleotide sequence of PSA mRNA is as SEQ ID NO.4), specifically as follows: the probe for capturing PCA3mRNA is 5'-atctgttttcctgcccatcctttaagttta( dA)30-3'(SEQ ID NO.5), the probe for capturing CST1mRNA is 5'-aaagagcacaactgtttcttctgca(dA)30-3'(SEQ ID NO.6), the probe for capturing CST4mRNA is 5'-taccaggtctattagaagca( dA) 30-3' (SEQ ID NO.7), the probe for capturing the internal reference gene PSA mRNA is 5' cgaacttgcgcacacacgtcattggattta (dA) 30-3' (SEQ ID NO.8), the above-mentioned specific probe can be combined with magnetic beads (...

Embodiment 2

[0055] Example 2, Detection of the expression of CST1 and CST4 in prostate cancer tissue

[0056] 30 prostate cancer and adjacent tissue samples were collected from the Urology Department of Shanghai Fifth People's Hospital, cut to the size of rice grains, stored in RNAlater preservation solution at -80°C, and equilibrated to room temperature before use. Then according to the method of Example 1, the CST1mRNA, CST4mRNA and PSA mRNA of the paired tissue of prostate cancer and adjacent cancer were respectively enriched, and then the detection primers of CST1, CST4 and internal reference gene PSA detection primer were used to detect 30 samples of prostate cancer and adjacent cancer. The relative expression levels of CST1 gene and CST4 gene in paired tissues, the detection system and detection conditions are the same as those in Example 1. The test results are 2 -ΔΔCP The relative expression was calculated by the method, and then the ratio (C / N) of the relative expression between...

Embodiment 3

[0057] Embodiment 3, construction prostate cancer detection kit

[0058] 1. Construction of PCA3 recombinant plasmid

[0059] The prostate cancer cell line LNcap was used as the material to extract the total mRNA of the prostate cancer cell line LNcap, and then the extracted mRNA was used as a template to synthesize cDNA, and the primers for constructing the PCA3 recombinant plasmid were designed according to the PCA3 gene sequence, and the upstream primer was 5'-gccgagggagaccaggaagat-3' (SEQ ID NO.17), the downstream primer is 5'-ggcccagaaggaaccgtagag-3' (SEQ ID NO.17), with the nucleotides shown in SEQ ID NO.17 and SEQ ID NO.18 as primers, the synthetic cDNA is The template was amplified by PCR, and the amplification conditions were: denaturation at 94°C for 5 minutes; 45 cycles of denaturation at 94°C for 30 seconds, annealing at 60°C for 30 seconds, and extension at 72°C for 1 minute; extension at 72°C for 5 minutes, and cooling at 4°C. The amplified product was connected...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Sensitivityaaaaaaaaaa
Login to View More

Abstract

The invention discloses application of PCA3, CST1 and CST4 to preparation of a prostate gland cancer marker and a kit of the PCA3, the CST1 and the CST4. The specificity and the sensitivity of a PCA3, CST1 and CST4 combination for diagnosing and indicating the prostate gland cancer are higher than those of the PCA3 as the marker. The kit is used for combined detection of the marker, is convenient to use, has the characteristics of being good in specificity and high in sensitivity, and can be used for diagnosing the prostate gland cancer, evaluating the treatment effect in a treatment process and monitoring the metastasis and relapse after the treatment; urine can be directly collected for detection without serum collection, so that the pain of patients during sampling is relieved; a guidance is provided for early intervention of doctors.

Description

technical field [0001] The invention belongs to the field of diagnosis, and specifically relates to the application of PCA3, CST1 and CST4 in the preparation of prostate cancer markers, and also relates to a corresponding diagnostic kit. Background technique [0002] The incidence of prostate cancer ranks first in male malignant tumors in western countries, and its death rate ranks second among various cancers, second only to lung cancer. In recent years, the incidence of prostate cancer in my country has shown an increasing trend year by year. At present, the diagnosis and follow-up of prostate cancer mainly adopts the combination of urine cytology examination and prostate microscopy, which is not only expensive, but also brings great pain to patients, and there are risks of infection and bleeding. It is difficult to effectively distinguish prostate cancer patients from benign lesions by detection methods such as PSA and DRE, resulting in excessive prostate biopsy, which b...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12Q1/68
CPCC12Q1/6886C12Q2600/106C12Q2600/118C12Q2600/158
Inventor王弢渠香云何林富高鹏
OwnerSHANGHAI LIANGRUN BIOMEDICINE TECH CO LTD