Method of cloning reproductive and respiratory syndrome resisting pig

A blue-ear disease and pig fiber-forming technology, which is applied in the fields of animal genetic engineering and genetic modification to achieve the effect of low cost and shortened time.

Inactive Publication Date: 2015-05-06
CHINA AGRI UNIV
View PDF3 Cites 75 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] CRISPR / Cas9-mediated homologous recombination has achieved precise gene editing in zebrafish, protozoa, mice, and rats, but it has not been reported in large livestock animals

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method of cloning reproductive and respiratory syndrome resisting pig
  • Method of cloning reproductive and respiratory syndrome resisting pig
  • Method of cloning reproductive and respiratory syndrome resisting pig

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] The construction of embodiment 1 porcine CD163 gene modification carrier

[0035] The vector construction process is divided into three steps, the process see figure 2 :

[0036] In the first step, exon 10 of human CD163-L1 (nucleotide sequence shown in SEQ ID NO.2) is fused with the homologous right arm. Using the genomic DNA of human cells as a template, exon 10 of human CD163L1 was amplified, and the primers used for the amplification were CD163L1-F5'-AAATGCTATTTTTCAGCCACAGGCAGCCCAGGCT-3' and CD163L1-R5'-CACATTCCCTGGGTCTCACGGGAACAGACAACTCCAACTT-3'. The PCR products were purified and sequenced to verify correctness. Using pig cell genomic DNA as a template, a 999bp homologous right arm (nucleotide sequence shown in SEQ ID NO.3) was amplified, and the primers were RIGHT-F5'-AAGTTGGAGTTGTCTGTTCCCGTGAGACCCAGGGAATGTG-3' and RIGHT-R 5'- TAT GTC GAC AGTGTTAGATAGATGTGCTC-3', the underline is the SalⅠ restriction site, and the sequence verification is correct. The exon...

Embodiment 2

[0039] Example 2 Construction of CRISPR-Cas9 Targeting Vector

[0040] 1. Use the website of Zhang Feng Laboratory (http: / / crispr.genome-engineering.org / ) to predict the targeting site of exon 7 of the porcine CD163 gene. According to the scores in the self-assessment and prediction results, two candidate target sites were selected, named 501 and 502, and their sgRNA sequences were GGAACTACAGTGCGGCACTG and ACTTCAACACGACCAGAGCA, respectively. Complementary paired oligonucleotides were synthesized according to the sgRNA sequence, as shown in Table 1, where the lowercase letters are restriction sites.

[0041] Table 1 Oligonucleotide sequence

[0042] name

Sequence (5'-3')

px330-501F

caccgGGAACTACAGTGCGGCACTG (SEQ ID NO. 5)

px330-501R

aaacCAGTGCCGCACTGTAGTTCCc (SEQ ID NO. 6)

px330-502F

caccgACTTCAACACGACCAGAGCA (SEQ ID NO. 7)

px330-502R

aaacTGCTCTGGTCGTGTTGAAGTc (SEQ ID NO. 8)

[0043] 2. A total of two targeting v...

Embodiment 3

[0052] Example 3 Screening and Identification of Positive Cell Monoclonal

[0053] 1. Screening of positive monoclonal cells

[0054] Digest and collect porcine fibroblasts in one well of a 6-well cell culture plate (approximately 1×10 6 1), the targeting vector px330-501 constructed in Example 2 and the porcine CD163 gene homologous recombination modification vector constructed in Example 1 were mixed according to the ratio of the amount of substances 1:1, and the total mass was 4 μg, according to Example 2 After transfection by the method in step 5, put into CO 2 In the incubator, cultivate at 37.5°C. After 48 hours, the confluence of the cells reached 80-90%. At this time, the cells in one well were evenly divided into eight 10cm culture dishes. After 24 hours, the cells adhered to the wall, and the medium was replaced with fibroblast medium (10% FBS+DMEM) containing G418 (600 μg / mL), and the medium was changed every 3 to 4 days. ) fibroblast culture medium. After the ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method of cloning a reproductive and respiratory syndrome resisting pig. The method comprises the following steps: transferring CRISPR / Cas9 targeting vectors and CD163 gene homologous recombination modification vectors into fibroblasts of a pig to obtain positive clone cells, wherein the seventh exon of the endogenous CD163 gene in the positive clone cells of the pig is replaced by the tenth exon of the CD163-L1 gene of human, so that the positive clone cells are incapable of mediating PRRSV invading; obtaining a clone embryo by adopting a somatic cell nucleus transfer technology by taking positive cells as nucleus transfer donor cells and oocytes as nucleus transfer recipient cells; and transferring the clone embryo into the uterus of the pig, and impregnating to obtain a cloned pig. The method provided by the invention is low in cost, the time of obtaining the homozygous pig is shortened greatly, the expression of the CD163 gene is not affected by gene editing, and a foundation is laid for the research into the gene function of large animals and the establishment of disease models on the basis of CRISPR / Cas9 mediated homologous recombination.

Description

technical field [0001] The invention belongs to the field of animal genetic engineering and genetic modification, and in particular relates to a CD163 genetic modification method of an anti-PRRS cloned pig by using a CRISPR / Cas9 system and a preparation method of an anti-PRRS cloned pig. Background technique [0002] Porcine reproductive and respiratory syndrome (PRRS), also known as blue ear disease, is caused by porcine reproductive and respiratory syndrome virus (PRRSV), with reproductive disorders in pregnant sows and respiratory symptoms of pigs of all ages as the main characteristic of infectious disease and cause severe immunosuppression. The disease first appeared in the United States in 1987, followed by an outbreak in Europe in 1989, and has gradually spread to other parts of the world since then. Frequent outbreaks of PRRS around the world have caused huge economic losses. For example, the "unknown high fever of pigs" caused by PRRSV mutant strains in China and V...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/873C12N15/85C12N15/12C12N15/11A01K67/027
CPCC12N15/113C12N9/22A01K67/0275A01K2267/0337C12N15/8778C12N2310/20C12N2800/80A01K2227/108A01K2217/072A01K67/0273A01K2217/05A61D19/04C12N15/11C12N15/85A01K67/027C12N15/873
Inventor李宁陈婧瑶李秋艳胡晓湘赵要风
OwnerCHINA AGRI UNIV