Molecular detection kit for determining resistance level of Escherichia coli to quinolone drugs based on high resolution melting curve

A quinolone, Escherichia coli technology, applied in the field of molecular detection kits, can solve the problems of reducing bacterial sensitivity, time-consuming and the like, and achieve the effect of accurate judgment

Inactive Publication Date: 2015-07-15
YANGZHOU UNIV
View PDF5 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Point mutations in the gene encoding topoisomerase II or the gene encoding topoisomerase IV may affect the combination of drugs and enzymes and reduce the sensitivity of bacteria to it
Applying conventional PCR to study the mechanism of bacterial drug resistance requires sequencing and analysis of the products after amplification, which takes a long time

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular detection kit for determining resistance level of Escherichia coli to quinolone drugs based on high resolution melting curve
  • Molecular detection kit for determining resistance level of Escherichia coli to quinolone drugs based on high resolution melting curve
  • Molecular detection kit for determining resistance level of Escherichia coli to quinolone drugs based on high resolution melting curve

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Gyrase A The nucleotide sequences of the primers and probes used in the FRET-qPCR detection method are as follows:

[0039] Upstream primer: 5’- ctttacgccatgaacgtactaggc -3’

[0040] Downstream primer: 5’- tttccgtaccgtcatagttatcaac -3’

[0041] Probe-1: 5’-ggggatggtatttaccgattacgtcaccaacgaca-6-FAM-3’

[0042] Probe-2: 5'-LCRED640-acgatcgtgtgtcataaaccgccgagtcacca-phospho-3'.

Embodiment 2

[0044] Preparation of standard quantitative reagents for PCR: synthesized by IDT Gyrase A The nucleic acid sequence of a gene covering the region amplified by PCR. Based on the molecular weight and absolute weight of the compound and PicoGreen's DNA quantification technology, the amount of DNA contained in the compound is calculated. Gyrase A Gene copy number. Subsequently, the compound was diluted to prepare dilution reagents containing 10000 copies, 1000 copies, 100 copies and 10 copies of the target gene per 10 μl of the compound, which were used as standard quantitative reagents for PCR.

[0045] Prepare the DNA template of the sample to be tested: nucleic acid extraction of Escherichia coli: tissues (semen, milk) known to contain E. 10 E. 0.1 (containing 10 mM Tris-HCl, 0.1 mM EDTA, pH 8.5) as the amplification template for PCR. Nucleic acid extraction of Escherichia coli: For organs known to contain Escherichia coli (liver, lung, intestine), weigh about 20 mg of the...

Embodiment 3

[0047] PCR amplification system: 20μl amplification system, including 10μl sample DNA template or quantitative standard reagent, 1xPCR buffer, 1μM upstream primer-1, 1μM downstream primer, 0.2μM 6-FAM probe, 0.2μM LCRed640 probe Needle, 2 units of commercial Taq enzyme, 200 μM dNTPs.

[0048] PCR amplification cycle parameters: PCR amplification includes 40 fluorescence acquisition cycles: 40 x 10 sec 95°C, 15 sec 56°C, 15 sec 72°C. After the PCR amplification, a high-resolution melting curve analysis is set up: the temperature is gradually increased from 45 °C to 85 °C, with an increment of 0.11 °C per second, and the change of fluorescence intensity is continuously monitored. Data analysis is to analyze the ratio of fluorescence intensity at 640 nm:530 nm (F4 / F1). The first derived value of F4 / F1 (-d(F4 / F1) / dt) is read as the melting temperature of the DNA.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a primer for determining the resistance level of Escherichia coli to quinolone drugs, and a probe and a molecular detection kit thereof. The kit can be used to rapidly, sensitively and accurately determine the resistance level of Escherichia coli to quinolone drugs, can specifically amplify the nucleic acid of Escherichia coli, does not amplify nucleic acids of other bacteria, viruses, parasites, plants or animals, can be used to various tissue organs and species original clinic samples without bacterial separation or purification, provides references for timely treatment and reasonable medication of diseases, and provides technical support for researches of the drug resistance mechanism.

Description

technical field [0001] The invention relates to a molecular detection kit for determining the drug resistance level of Escherichia coli to quinolones based on a high-resolution melting curve. Background technique [0002] Since the first use of quinolones, they have been widely used in the medical field due to their broad-spectrum, high efficiency and unique antibacterial mechanism. Unreasonable use and complex drug resistance mechanisms have led to increasingly serious bacterial resistance to this class of drugs, seriously restricting their use. Therefore, it is urgent to study the problem of drug resistance of this type of drug. However, the current method for judging the level of bacterial resistance to quinolones is still based on traditional drug susceptibility testing, which often takes several days from sample collection to reporting results, which hinders people from choosing sensitive drugs in a timely and reasonable manner. [0003] At present, studies have found...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12Q1/10C12N15/11C12R1/19
CPCC12Q1/689C12Q1/686
Inventor王成明危蓝菁成大荣陆光武朱国强龚建森
OwnerYANGZHOU UNIV