Application of lrk2 Gene in Improving Rice's Ability to Resist Drought
A gene and rice technology, applied in the application field of LRK2 gene in improving the ability of rice to resist drought, can solve the problems that the function has not been verified and cannot support the development of traditional rice
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0117] Embodiment 1, construction carrier
[0118] 1) Primers used to construct the vector:
[0119] LRK2-1300-KpnI-F: GTCGGTACCATGCAGCCACCTCATTCTTCATGCAAC;
[0120] LRK2-1300-SalI-R: CAGGTCGACTCAGTCGGAGCCTACACTGTCCAG;
[0121] 2) Recombinant vector
[0122] A. The acquisition of the LRK2 gene:
[0123] ① Extract the total DNA of rice, as described in step 1 above.
[0124] ②Using DNA as template and LRK2-1300-KpnI-F and LRK2-1300-SalI-R as primers, LRK2 gene fragment was amplified by PCR.
[0125] PCR system:
[0126]
[0127] B. Build a graph such as figure 1 as shown,
[0128] ①PCR amplified gene fragment (as above);
[0129] ②PCR product recovery;
[0130] ③ pCAMBIA1300S vector and gene fragment digestion;
[0131] Enzyme cutting system:
[0132]
[0133] Enzyme digestion reaction at 37°C for 3hours.
[0134] ④ Enzymatic digestion products were recovered by cutting gel (same as above, using Shanghai Sangong Gel Recovery Kit);
[0135] ⑤ connection;
[0...
Embodiment 2
[0154] Embodiment 2, the acquisition and identification of transgenic rice
[0155] 1. Competent preparation of Agrobacterium
[0156] (1) Take out the GV3101 strain at -80°C, streak on the LB medium plate added with 50Hg / mLRif, and culture at 28°C for 2 days.
[0157] (2) Pick 1-10 single clones and inoculate them in 250 mL LB liquid medium containing 50 μg / mL Rif,
[0158] Culture at 18°C until OD_=0.6.
[0159] (3) Centrifuge at 4°C for 15min at 5000rpm, discard the supernatant.
[0160] (4) Add 250mL PCR H 2 O (cold in advance), centrifuge at 4°C for 15min, 5000rpm, and discard the supernatant.
[0161] (5) Add 125mL PCR H 2 O (cold in advance), centrifuge at 4°C for 15min at 5000rpm, and discard the supernatant.
[0162] (6) Add 50mL PCR H 2 O (cold in advance), centrifuge at 4°C for 15niin, 5000rpm, and discard the supernatant.
[0163] (7) Add 25mL of 10% glycerol (cooled in advance), centrifuge at 4°C for 15min at 5000rpm, and discard the supernatant.
[016...
Embodiment 3
[0207] Related experimental reagents and steps for simulated drought treatment:
[0208] Conventional drugs: CaCl 2 Purchased from Jinhua Pharmaceutical Co., Ltd.; PEG6000 was purchased from Sigm Company.
[0209] PEG600020% solution: Weigh 400g PEG6000, add tap water to a 2L measuring cylinder, put it in a 65°C oven to dissolve for 3-6 hours, stir until completely dissolved, and store it at room temperature for later use.
[0210] 1M CaCl 2 Solution: weigh 111g anhydrous CaCl 2 Dissolve in an appropriate amount of deionized water, and dilute to 1000mL.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


