Unlock instant, AI-driven research and patent intelligence for your innovation.

Application of lrk2 Gene in Improving Rice's Ability to Resist Drought

A gene and rice technology, applied in the application field of LRK2 gene in improving the ability of rice to resist drought, can solve the problems that the function has not been verified and cannot support the development of traditional rice

Active Publication Date: 2018-03-02
ZHEJIANG NORMAL UNIVERSITY
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In 2030, my country's population will reach 1.6 billion. In order to meet food demand, there will be a huge gap in agricultural water use. The shortage of water resources will become the bottleneck of my country's food security in the 21st century. my country's water resource conditions cannot support the further development of traditional rice.
There are not many LRK genes that have been identified in rice, mainly: Xa21, Xa26, OsSERK1, etc., and the functions of most receptor-like kinases in rice have not been verified

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of lrk2 Gene in Improving Rice's Ability to Resist Drought
  • Application of lrk2 Gene in Improving Rice's Ability to Resist Drought
  • Application of lrk2 Gene in Improving Rice's Ability to Resist Drought

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0117] Embodiment 1, construction carrier

[0118] 1) Primers used to construct the vector:

[0119] LRK2-1300-KpnI-F: GTCGGTACCATGCAGCCACCTCATTCTTCATGCAAC;

[0120] LRK2-1300-SalI-R: CAGGTCGACTCAGTCGGAGCCTACACTGTCCAG;

[0121] 2) Recombinant vector

[0122] A. The acquisition of the LRK2 gene:

[0123] ① Extract the total DNA of rice, as described in step 1 above.

[0124] ②Using DNA as template and LRK2-1300-KpnI-F and LRK2-1300-SalI-R as primers, LRK2 gene fragment was amplified by PCR.

[0125] PCR system:

[0126]

[0127] B. Build a graph such as figure 1 as shown,

[0128] ①PCR amplified gene fragment (as above);

[0129] ②PCR product recovery;

[0130] ③ pCAMBIA1300S vector and gene fragment digestion;

[0131] Enzyme cutting system:

[0132]

[0133] Enzyme digestion reaction at 37°C for 3hours.

[0134] ④ Enzymatic digestion products were recovered by cutting gel (same as above, using Shanghai Sangong Gel Recovery Kit);

[0135] ⑤ connection;

[0...

Embodiment 2

[0154] Embodiment 2, the acquisition and identification of transgenic rice

[0155] 1. Competent preparation of Agrobacterium

[0156] (1) Take out the GV3101 strain at -80°C, streak on the LB medium plate added with 50Hg / mLRif, and culture at 28°C for 2 days.

[0157] (2) Pick 1-10 single clones and inoculate them in 250 mL LB liquid medium containing 50 μg / mL Rif,

[0158] Culture at 18°C ​​until OD_=0.6.

[0159] (3) Centrifuge at 4°C for 15min at 5000rpm, discard the supernatant.

[0160] (4) Add 250mL PCR H 2 O (cold in advance), centrifuge at 4°C for 15min, 5000rpm, and discard the supernatant.

[0161] (5) Add 125mL PCR H 2 O (cold in advance), centrifuge at 4°C for 15min at 5000rpm, and discard the supernatant.

[0162] (6) Add 50mL PCR H 2 O (cold in advance), centrifuge at 4°C for 15niin, 5000rpm, and discard the supernatant.

[0163] (7) Add 25mL of 10% glycerol (cooled in advance), centrifuge at 4°C for 15min at 5000rpm, and discard the supernatant.

[016...

Embodiment 3

[0207] Related experimental reagents and steps for simulated drought treatment:

[0208] Conventional drugs: CaCl 2 Purchased from Jinhua Pharmaceutical Co., Ltd.; PEG6000 was purchased from Sigm Company.

[0209] PEG600020% solution: Weigh 400g PEG6000, add tap water to a 2L measuring cylinder, put it in a 65°C oven to dissolve for 3-6 hours, stir until completely dissolved, and store it at room temperature for later use.

[0210] 1M CaCl 2 Solution: weigh 111g anhydrous CaCl 2 Dissolve in an appropriate amount of deionized water, and dilute to 1000mL.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an application of an LRK2 gene or a recombinant vector containing the LRK2 gene in improving the drought resistance ability of rice. The nucleotide sequence of the LRK2 gene is shown in SEQ ID NO.1; the amino acid sequence of the expressed protein of the LRK2 gene is shown in SEQ ID NO.2; the recombinant vector containing the LRK2 gene is obtained by inserting the LRK2 gene into the expression vector Expression vector. Specifically, the recombinant vector is the expression vector pCAMBIA1300S-2×35S::LRK2 obtained by inserting the LRK2 gene into the pCAMBIA1300S expression vector, using twice the 35S as the promoter, and using KpnI and SalI as restriction sites.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to an application of LRK2 gene in improving the ability of rice to resist drought. Background technique [0002] As one of the three major food crops in the world, rice is the staple food for nearly half of the world's population. my country also has nearly 65% ​​of the population to eat rice as a staple food. However, the reduction and uneven distribution of precipitation worldwide have a great impact on rice production. Agricultural water consumption accounts for 68% of the country's total water consumption, while rice water consumption accounts for 60% of agricultural water consumption (data released by the Ministry of Agriculture in 2008). However, mainly due to interannual variation in rainfall patterns and uneven distribution of rainfall during rice growing seasons, drought stress is still the most important single factor restricting rice production, especially in re...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/54C12N9/12C12N15/82A01H5/00A01H6/46
Inventor 查笑君康君方高爽潘建伟马伯军李健敏田超魏宇桑柴飘飘
Owner ZHEJIANG NORMAL UNIVERSITY