Unlock instant, AI-driven research and patent intelligence for your innovation.

Crispr/Cas9-induced scale-missing zebra fish mode and establishment method

A technology of zebrafish and scales, applied in the field of genetic engineering

Inactive Publication Date: 2015-09-23
CHINA ACAD OF SCI NORTHWEST HIGHLAND BIOLOGY INST
View PDF2 Cites 54 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

TNF is the functional domain of Eetodysplasin. However, some mutations found in patients show that the collagen region also plays an important role. This region contains 19 G-X-Y repeats, 2 G-X-Y repeats or 4 G-X-Y repeat deletions in the reading frame Although it does not affect the function of the TNF domain, it can also cause EDA syndrome

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Crispr/Cas9-induced scale-missing zebra fish mode and establishment method
  • Crispr/Cas9-induced scale-missing zebra fish mode and establishment method
  • Crispr/Cas9-induced scale-missing zebra fish mode and establishment method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Example 1 A scale-deleted zebrafish model induced by Crispr / Cas9, which refers to a scale-deleted zebrafish that contains a base insertion at the exon 4 site of the EDA gene.

[0038] The establishment method of the scale-deficient zebrafish model comprises the following steps:

[0039] (1) Using the Ensemble online database, search for the zebrafish EDA gene sequence no: ENSDARG00000074591 and download it, and search for the PAM (protospacer-adjacent motif) sequence in this sequence, namely 5'-GGNNNNNNNNNNNNNNNNNNNNNGG-3', the targeting effect found in the exons of the EDA gene The sequence is TTAGGCAAGAAAGGGCCCCC [TGG], and the mutation detection primer F-eda: ttgttttgcttctcatcagttg and the mutation detection primer R-eda: tttgctctgctgcttcactc are designed and designed.

[0040] (2) Sequencing verification of the wild-type allele of the target sequence:

[0041] Five 24hpf wild-type zebrafish embryos were randomly selected, the genomic DNA template was extracte...

Embodiment 2

[0071] Example 2 The scale-deleted zebrafish model was applied to the verification of the function of skin attachment-related genes and the screening of drugs for ectodermal dysplasia.

[0072] PAM sequence

[0073] 5'-GGNNNNNNNNNNNNNNNNNNNGG-3'

[0074]

[0075] targeting sequence

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a Crispr / Cas9-induced scale-missing zebra fish mode. The mode is scale-missing zebra fish containing EDA gene exon 4-locus base insertion. Meanwhile, the invention also discloses an establishment method and the application of the Crispr / Cas9-induced scale-missing zebra fish mode. The established scale-missing zebra fish mode has a great application value in functional research of related genes of appendages of the skin, screening of medicines for treating ectoderm dysplasia such as human baldness, and the like.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to a model and establishment method of a scale-deleted zebrafish induced by Crispr / Cas9. Background technique [0002] Hair, teeth, nails, sweat glands of humans and mammals, feathers of birds, scales of fish, hypopharyngeal teeth, tentacles, etc. are all skin appendages, and the development of skin appendages is very important to humans, and skin appendages Dysplasia patients have familial heredity, and this phenomenon has also been found in mice and fish. It has been confirmed through genetic studies that the development of skin appendages is mainly regulated by EDA family genes. [0003] Eda (Eetodysplasin) and its receptor Edar is associated with TNF and belongs to the TNF superfamily member. EDA signaling is regulated by Eetodysplasin, EDAR, and EDARADD, forming a TNF ligand in the regulation of vertebrate skin appendages from fish to humans- Receptor-aptamer famil...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/89C12N15/55C12N15/11A01K67/027
Inventor 张存芳赵凯童超刘思嘉汤永涛冯晨光张仁意李国刚
Owner CHINA ACAD OF SCI NORTHWEST HIGHLAND BIOLOGY INST