Genotype VII Newcastle disease virus marker vaccine strain and application thereof

A technology for Newcastle disease virus and vaccine strains, applied in the direction of antiviral agents, virus/phage, virus antigen components, etc., to achieve the effect of genetic stability and good immunogenicity

Active Publication Date: 2015-10-21
LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
View PDF2 Cites 18 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Therefore, the above two vaccines cannot provide strong immune protection in clinical application, which also explains why Newcastle disease is still prevalent in some areas

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Genotype VII Newcastle disease virus marker vaccine strain and application thereof
  • Genotype VII Newcastle disease virus marker vaccine strain and application thereof
  • Genotype VII Newcastle disease virus marker vaccine strain and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] Example 1 MG7-NP△18 and MG7-NP mut3 strain rescue

[0044] 1. Experimental method

[0045] 1.1 Construction of full-length cDNA of G7 strain genome

[0046] Using the Trizol method to extract the genomic RNA in the allantoic fluid inoculated with chicken embryos of the G7 strain, the detailed steps are as follows:

[0047] ① Take 250 μL of chicken embryo allantoic fluid, add 750 μL Trizol (Invitrogen, USA), shake and mix well, and let stand at room temperature for 5 minutes;

[0048] ② Add 200 μL of chloroform to each tube, cap the centrifuge tube tightly, shake the centrifuge tube vigorously for 15 seconds; place at room temperature for 10 minutes, and centrifuge at 12000 rpm for 15 minutes;

[0049] ③ Take the upper aqueous phase and place it in a new centrifuge tube, add 700 μL of isopropanol, place at 4°C for 10 minutes, and centrifuge at 12,000 rpm for 10 minutes;

[0050] ④ Discard the supernatant, add 1mL 75% ethanol, mix well, and centrifuge at 8500g for 5 m...

Embodiment 2

[0087] Example 2 MG7-NP△18+F mut Rescue of labeled vaccine strains

[0088] 1. Experimental method

[0089] 1.1 Mutation of cleavage site of F protein of MG7-NP△18 strain and construction of full-length cDNA

[0090] MG7-NPΔ18 and MG7-NP rescued by Example 1 of the present invention mut3 Strain virus virulence is not obviously weakened, therefore, on the basis of the plasmid pMG7-NP△18 constructed in Example 1, the present invention mutates the F protein cleavage site, and the F protein cleavage site RRQKRF is mutated to GRQGRL, GRQKRF respectively , RRQGRF and RRQKRL, the mutant plasmid pMG7-NP△18+F was obtained mut , pMG7-NP△18+F mut-1 , pMG7-NP△18+F mut-2 and pMG7-NP△18+F mut-3 .

[0091] Primers used to mutate the F protein cleavage site are as follows:

[0092] F7: 5'CTCCGACCAAAACCCCCCACACTCCCTG3';

[0093] R7:5'AGAGTAGAGAAGAATACCCTCCCTGTTGCAG3';

[0094] F8: 5'TCTGTGTCCACGTCTGGAGGAGGGAGACAGGGGCGCCTTATAGGTGCTGTTATTGGCAG3';

[0095] R8: 5'CTGCCAATAACAGCACCTATAAG...

Embodiment 3

[0127] Example 3 MG7-NP△18+F mut Experiment of immune effect of labeled vaccine strains on SPF chickens

[0128] 1. Experimental method

[0129] For measuring the MG7-NP △ 18+F rescued by the embodiment of the present invention 2 mut Marked vaccine strain (microorganism preservation number is: CCTCC NO: V201505; for the immune protection of 4-week-old SPF chickens, use 9-day-old SPF chicken embryos to amplify the virus, collect allantoic fluid, and measure the EID of the marked vaccine strain 50 5.62×10 9 / mL, when preparing a vaccine, the virus was diluted to 3.16×10 9 / mL.

[0130] The virus is inactivated after dilution. The specific operation is: first dilute the analytically pure formaldehyde (no crystal) solution with sterilized physiological saline at 1:10, then add the diluted formaldehyde solution to the virus solution, and shake it while adding it. The final concentration of formaldehyde solution is 0.15% (for example, add 1 mL of formaldehyde solution diluted 1...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a genotype VII Newcastle disease virus marker vaccine strain and an application thereof, and belongs to the field of genotype VII Newcastle disease virus marker vaccine strain rescue and application. A built Newcastle disease virus reverse genetic operating platform is utilized for enabling NP protein of a G7 strain to miss 18 amino acids and conducting mutation on F-protein cleavage loci, and the highly-weak virulence and high-virus titer genotype VII Newcastle disease virus marker vaccine strain MG7-NPdelta18+Fmut is rescued through screening. The microbial preservation serial number is CCTCC NO: V201505. The marker vaccine strain has the biological characteristics of high growth titer and low virulence in chick embryos and is genetically stable. The immune protection test result shows that the marker vaccine strain is good in immunogenicity, capable of inducing high-level protective antibodies, and capable of completely protecting immunized chicken, can be used for preventing and controlling a currently-popular genotype VII Newcastle disease virus and lays the foundation of identifying vaccine immunity and wild virus infection.

Description

technical field [0001] The present invention relates to gene VII type Newcastle disease virus, in particular to gene VII type Newcastle disease virus marker vaccine strain MG7-NP△18+F mut , the present invention also relates to said MG7-NP△18+F mut The application of the strain in preparing gene VII Newcastle disease vaccine belongs to the rescue and application field of gene VII Newcastle disease virus marker vaccine strain. Background technique [0002] Newcastle disease is an acute and highly contagious poultry disease caused by Newcastle Disease Virus (NDV), which mainly affects chickens and turkeys. It is recognized as one of the two most important poultry infectious diseases in the world. [0003] At present, two attenuated vaccines or inactivated vaccines, LaSota and Hitcher B1, are mainly used in the prevention and control of Newcastle disease, and they have been used as vaccine strains for decades. Both LaSota and Hitcher B1 strains belong to genotype II, while th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N7/00A61K39/17A61P31/14C12R1/93
Inventor 朱启运吉艳红付钰广
Owner LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap