Unlock instant, AI-driven research and patent intelligence for your innovation.

A detection kit and detection method for soluble st2 in blood of patients with aortic aneurysm and/or aortic dissection

A technology for aortic dissection and aortic aneurysm, which is applied in chemical instruments and methods, anti-animal/human immunoglobulin, biological testing, etc. It can solve the problems of short half-life and lack of specificity, and achieve simple operation and high specificity. Effects of Sex and Sensitivity

Active Publication Date: 2017-03-22
华新安平(北京)生物医药有限公司
View PDF7 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In terms of molecular markers, a series of biomarkers such as C-reactive protein, D-dimer, smooth muscle myosin heavy chain, and calmodulin may be associated with the occurrence of acute aortic dissection. For the diagnosis of aortic aneurysm, Some cytokines up-regulated by immune response, such as interleukin-1β, IL-6, IL-8, tumor necrosis factor-α (tumour necrosis factor-α) and CC chemokines have attracted the attention of researchers. For matrix metalloproteinases , especially the association between MMP-9 and other proteins tPA, Fibrinogen, and D-dimmer, and the occurrence of aortic aneurysms have also been reported, but due to lack of specificity, short half-life, or limitations of false lumen thrombosis and other factors, they have not been reported. Widely used in clinical diagnosis and treatment

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A detection kit and detection method for soluble st2 in blood of patients with aortic aneurysm and/or aortic dissection
  • A detection kit and detection method for soluble st2 in blood of patients with aortic aneurysm and/or aortic dissection
  • A detection kit and detection method for soluble st2 in blood of patients with aortic aneurysm and/or aortic dissection

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0053] Embodiment 1, the preparation of sST2 monoclonal antibody

[0054] 1. Preparation of immunogen

[0055] 1. Design of primers

[0056] The sequence of human soluble ST2 protein was analyzed by protein sequence and secondary structure analysis software, and the region suitable for recombinant expression was selected according to the surface accessibility, hydrophilicity and hydrophobicity, secondary structure and amino acid composition of its structural domain / sequence, and a design was made. The upstream and downstream primers shown below were synthesized by Sangon Bioengineering (Shanghai) Co., Ltd.: ST2-F: 5'-CCAAGTTTAAACGGATCTCTAGCGAATTCGCCGCCACCATGGACTTTGGGCT CAGCTTGG-3'; ST2-R: 5'-CAAGGATCCTTGCTTCTGGGCAGCCAAGGG-3'.

[0057] 2. Acquisition of st2 gene

[0058] The human liver cell line HepG2 (purchased from ATCC, HB-8065) ​​was taken, RNA was extracted by Trizol method, reverse transcription was performed with Poly-T primers, and cDNA was obtained; the obtained cDN...

Embodiment 2

[0118] Example 2, a double-antibody sandwich ELISA kit for detecting sST2 content and its detection method

[0119] 1. The composition of the kit

[0120] The double-antibody sandwich ELISA kit of the present invention includes the sST2 capture antibody prepared in Example 1 coated on the microtiter plate, the sST2 detection antibody labeled with horseradish peroxidase (HRP) and the sST2 protein standard (R&D system, DST200), sample diluent, blocking solution, chromogenic solution and stop solution.

[0121] Preparation method of sST2 detection antibody labeled with horseradish peroxidase:

[0122] 1. Weigh 6 mg of HRP (horseradish peroxidase, purchased from Sigma) and dissolve it in 1 mL of three-distilled water, slowly add 0.30 mL of newly prepared 0.1M NaIO to each mL of solution drop by drop 4 The solution was stirred at 4°C in the dark for 35 minutes to activate HRP, and the color changed from brown to green. The above solution was put into a dialysis bag, and dialyzed...

Embodiment 3

[0132] The preparation of embodiment 3, sST2 immune colloidal gold test strip

[0133] 1. Preparation of colloidal gold

[0134] Get 3 milliliters of 1% tetrachloroauric acid in a 500 milliliter round-bottom flask with a 5 milliliter micropipette, measure 297 milliliters of ultrapure water and also add in the flask, be mixed with 0.01% tetrachloroauric acid reaction solution, Stir and mix well, place on a magnetic heating stirrer, and heat to boil. After fully stirring, quickly add 3 ml of ammonium citrate solution, the chloroauric acid aqueous solution turns from gold to gray, and turns purple after about 2 minutes. Continue to boil for 5 minutes and stop heating. After the colloidal gold cools down, divide it into glass reagents in the bottle.

[0135] 2. Preparation of immunogold

[0136]Calculate the required mass of protein to be labeled according to the total amount of colloidal gold to be labeled. Use 0.1M potassium carbonate or 0.1M hydrochloric acid to adjust the ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention discloses a kit and a method for detecting sST2 (soluble ST2) in blood of an abdominal aortic aneurysm and / or aortic dissection patient. According to the kit and the method, a pair of antibodies for identifying different epitopes of sST2 is assembled to obtain a double-antibody sandwich ELISA and immune colloidal gold test strip, so as to realize quantitive and qualitative detection of sST2. Tests prove that the ELISA kit and the immune colloidal gold test strip have relatively high specificity and sensitivity in an abdominal aortic aneurysm marker-sST2 protein of human, are simple to operate, can be utilized for detecting abdominal aortic aneurysm, aortic dissection and other diseases in scientific research and clinical application, and have the functions of auxiliary diagnosis, guide treatment and prognosis judgment.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to a detection kit and detection method for soluble ST2 in the blood of patients with aortic aneurysm and / or aortic dissection, in particular to a method for rapidly quantitatively or qualitatively detecting human whole blood, serum and / or Immunological detection kit for aortic aneurysm and / or aortic dissection marker-soluble ST2 content in plasma. Background technique [0002] Soluble ST2 (sST2), also known as IL1RL1, is a member of the Toll-like receptor superfamily, but unlike other members, sST2 cannot trigger infection by activating NF-κB. As a member of the receptor family of interleukin-1, ST2 protein has two forms, soluble form (sST2, soluble ST2) and membrane-bound receptor form (membrane-bound receptor form, ST2 receptor). The functional ligand of ST2 is IL-33, and the content of ST2 and IL-33 increases after cardiomyocytes and fibroblasts are mechanically stretched. Recent st...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K16/28G01N33/68G01N33/574G01N33/535
CPCC07K16/2866G01N33/535G01N33/57484G01N33/6893G01N2333/7155G01N2800/329
Inventor 杜杰王媛檀鑫
Owner 华新安平(北京)生物医药有限公司