A detection kit and detection method for soluble st2 in blood of patients with aortic aneurysm and/or aortic dissection
A technology for aortic dissection and aortic aneurysm, which is applied in chemical instruments and methods, anti-animal/human immunoglobulin, biological testing, etc. It can solve the problems of short half-life and lack of specificity, and achieve simple operation and high specificity. Effects of Sex and Sensitivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0053] Embodiment 1, the preparation of sST2 monoclonal antibody
[0054] 1. Preparation of immunogen
[0055] 1. Design of primers
[0056] The sequence of human soluble ST2 protein was analyzed by protein sequence and secondary structure analysis software, and the region suitable for recombinant expression was selected according to the surface accessibility, hydrophilicity and hydrophobicity, secondary structure and amino acid composition of its structural domain / sequence, and a design was made. The upstream and downstream primers shown below were synthesized by Sangon Bioengineering (Shanghai) Co., Ltd.: ST2-F: 5'-CCAAGTTTAAACGGATCTCTAGCGAATTCGCCGCCACCATGGACTTTGGGCT CAGCTTGG-3'; ST2-R: 5'-CAAGGATCCTTGCTTCTGGGCAGCCAAGGG-3'.
[0057] 2. Acquisition of st2 gene
[0058] The human liver cell line HepG2 (purchased from ATCC, HB-8065) was taken, RNA was extracted by Trizol method, reverse transcription was performed with Poly-T primers, and cDNA was obtained; the obtained cDN...
Embodiment 2
[0118] Example 2, a double-antibody sandwich ELISA kit for detecting sST2 content and its detection method
[0119] 1. The composition of the kit
[0120] The double-antibody sandwich ELISA kit of the present invention includes the sST2 capture antibody prepared in Example 1 coated on the microtiter plate, the sST2 detection antibody labeled with horseradish peroxidase (HRP) and the sST2 protein standard (R&D system, DST200), sample diluent, blocking solution, chromogenic solution and stop solution.
[0121] Preparation method of sST2 detection antibody labeled with horseradish peroxidase:
[0122] 1. Weigh 6 mg of HRP (horseradish peroxidase, purchased from Sigma) and dissolve it in 1 mL of three-distilled water, slowly add 0.30 mL of newly prepared 0.1M NaIO to each mL of solution drop by drop 4 The solution was stirred at 4°C in the dark for 35 minutes to activate HRP, and the color changed from brown to green. The above solution was put into a dialysis bag, and dialyzed...
Embodiment 3
[0132] The preparation of embodiment 3, sST2 immune colloidal gold test strip
[0133] 1. Preparation of colloidal gold
[0134] Get 3 milliliters of 1% tetrachloroauric acid in a 500 milliliter round-bottom flask with a 5 milliliter micropipette, measure 297 milliliters of ultrapure water and also add in the flask, be mixed with 0.01% tetrachloroauric acid reaction solution, Stir and mix well, place on a magnetic heating stirrer, and heat to boil. After fully stirring, quickly add 3 ml of ammonium citrate solution, the chloroauric acid aqueous solution turns from gold to gray, and turns purple after about 2 minutes. Continue to boil for 5 minutes and stop heating. After the colloidal gold cools down, divide it into glass reagents in the bottle.
[0135] 2. Preparation of immunogold
[0136]Calculate the required mass of protein to be labeled according to the total amount of colloidal gold to be labeled. Use 0.1M potassium carbonate or 0.1M hydrochloric acid to adjust the ...
PUM
| Property | Measurement | Unit |
|---|---|---|
| molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 


