Check patentability & draft patents in minutes with Patsnap Eureka AI!

A recombinant Escherichia coli strain highly expressing [2fe2s] ferredoxin and its application

A recombinant Escherichia coli and high-efficiency expression technology, which is applied to recombinant Escherichia coli expressing [2Fe2S]ferredoxin with high efficiency and its application field, can solve the problems of high protein price, low expression amount and low activity, and achieves good application prospects , the effect of high expression and yield improvement

Inactive Publication Date: 2019-03-05
INST OF BASIC MEDICINE OF SAMS
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, only the [2Fe2S] type ferredoxin from spinach is commercially sold. However, due to species differences, this ferredoxin shows different efficiencies when analyzing enzymes from other species, and the protein is very expensive , which largely limits the application of ferredoxin and scientists' research on ferredoxin-related enzymes and metabolic processes
[0003] In the existing literature reports, most ferredoxins are purified from wild bacteria and other organisms, and are also prepared by heterologous expression, but these methods have many shortcomings, such as consuming a lot of time and cumbersome purification steps , low expression, incomplete iron-sulfur cluster assembly of ferredoxin and low activity, low final yield and purity, etc.
Based on this, the research and development of methods capable of efficiently expressing [2Fe2S] ferredoxin has become an urgent problem to be solved. After searching, there are related recombinant Escherichia coli that can efficiently express [2Fe2S] ferredoxin and its production of [2Fe2S ] The application of ferredoxin has not been reported yet

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A recombinant Escherichia coli strain highly expressing [2fe2s] ferredoxin and its application
  • A recombinant Escherichia coli strain highly expressing [2fe2s] ferredoxin and its application
  • A recombinant Escherichia coli strain highly expressing [2fe2s] ferredoxin and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1: Construction of recombinant Escherichia coli highly expressing [2Fe2S]-type ferredoxin in C.pasteurianum DSM 525

[0035]Take C.pasteurianum DSM 525 cells, and extract genomic DNA from C.pasteurianum DSM 525 cells according to the method recommended by the bacterial genomic DNA extraction kit. According to the known [2Fe2S] type ferredoxin gene sequence in the genome of Clostridium pasteurianum (C.pasteurianum) DSM 525 as shown in SEQ ID NO.1, the primers were designed as follows:

[0036] F Primer: 5'CGCGGATCCGATGGTAAACCCAAAACAC 3'

[0037] R primer: 5' CCCAAGCTTAATTTGAAGTCTTTTAAC 3'

[0038] The extracted C. pasteurianum DSM 525 genomic DNA was used as a template for PCR amplification to obtain [2Fe2S]-type ferredoxin gene. The PCR reaction system is as follows:

[0039]

[0040]

[0041] The PCR reaction conditions are:

[0042] 95℃5min

[0043] 95°C 30s, 55°C 30s, 72°C 30s 30 cycles

[0044] 72℃10min

[0045] 4°C insulation

[0046] After th...

Embodiment 2

[0052] Embodiment 2: the application of recombinant escherichia coli highly expressed [2Fe2S] ferredoxin

[0053] (1) Inoculate the recombinant Escherichia coli strain constructed in Example 1 into the TB medium containing antibiotics and iron-sulfur sources with an inoculum size of 1% by volume, and cultivate it at 37°C and 180rpm for 2 to 3 hours to OD 620nm is 0.6, the bacterial liquid is obtained;

[0054] Among them, the formula and final concentration of components of the above-mentioned TB medium are: Tryptone 12g / L, Yeast extract24g / L, Glycerol 4ml / L, KH 2 PO 4 2.3g / L, K 2 HPO 4 12.5g / L;

[0055] The above-mentioned antibiotics are chloramphenicol with a final concentration of 25 μg / ml, tetracycline with a final concentration of 10 μg / ml, and ampicillin with a final concentration of 100 μg / ml;

[0056] The formula and final concentration of the above-mentioned iron and sulfur sources are: ferric ammonium citrate 0.2-0.3g / L, L-cysteine ​​0.1-0.2g / L, ferric citrat...

Embodiment 3

[0060] Example 3: Separation, purification and activity determination of [2Fe2S]ferredoxin.

[0061] The purification of protein was carried out in an anaerobic operation box, and all solutions used were degassed and anaerobic treated after boiling.

[0062] Prepare the buffer required for purification: buffer A: sodium phosphate 20mM, NaCl 0.5M, pH 7.4; buffer B: sodium phosphate 20mM, NaCl 0.5M, imidazole 500mM, pH 7.4; the formula of buffer W is: sodium phosphate 50mM, pH 7.4; Buffer W: Sodium Phosphate 50mM, pH 7.0.

[0063] Acquisition of crude enzyme solution: resuspend the frozen cells prepared in Example 2 with buffer A containing 10% glycerol, and use an ultrasonic disruptor to disrupt the cells. The cell disruption procedure is: working time 6 seconds, intermittent time 6 seconds , power 39%, total crushing time is 50 minutes. After the crushing is completed, centrifuge at 12,000 rpm for 30 minutes, take the supernatant and filter it with a 0.22um pore size filter ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses recombinant Escherichia coli with efficiently expressed [2Fe2S] ferredoxin. The recombinant Escherichia coli is named as Escherichia coli pCodonPlus / pRKISC / pETDuet-[2Fe2S]Fd and contains [2Fe2S] ferredoxin genes. Nucleotide sequences of the recombinant Escherichia coli are shown as SEQ ID NO.1. The [2Fe2S] ferredoxin genes are connected into pETDuet-1 carriers to obtain recombinant plasmids of the recombinant Escherichia coli, and the obtained recombinant plasmids are named as pETDuet-[2Fe2S] and are transferred into E.coli C41(DE3) with pCodonPlus and pRKISC plasmids to obtain the recombinant Escherichia coli. The invention further discloses application of the recombinant Escherichia coli to fermenting and producing the [2Fe2S] ferredoxin. The recombinant Escherichia coli and the application have the advantages that as proved by experiments, 40 mg of purified [2Fe2S] ferredoxin can be ultimately obtained from each liter of fermentation culture, the yield of the purified [2Fe2S] ferredoxin is far higher than previously reported 2mg yield of [2Fe2S] ferredoxin expressed in existing recombinant Escherichia coli and 0.2mg yield of [2Fe2S] ferredoxin purified from wild fungi, and the recombinant Escherichia coli is predicted to have an excellent application prospect in industrial production.

Description

technical field [0001] The invention relates to gene recombination engineering bacteria and its application, in particular to a recombinant Escherichia coli highly expressing [2Fe2S] ferredoxin and its application. Background technique [0002] Ferredoxin is a kind of acidic protein containing iron-sulfur clusters, and the iron-sulfur clusters are mainly divided into [4Fe4S], [2Fe2S], [3Fe4S] and other types. As a common electron carrier, ferredoxin participates in important metabolic processes such as respiration, photosynthesis, and fermentation. At present, only the [2Fe2S] type ferredoxin from spinach is sold commercially. However, due to species differences, this ferredoxin shows different efficiencies when analyzing enzymes from other species, and the protein is very expensive , which largely limits the application of ferredoxin and scientists' research on ferredoxin-related enzymes and metabolic processes. [0003] In the existing literature reports, most ferredoxin...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N1/21C12P21/02C12N15/70C12R1/19
CPCC07K14/245C12P21/02
Inventor 黄海燕王书宁胡烈杰许晓群王郡甫栾俊文苏庆红
Owner INST OF BASIC MEDICINE OF SAMS
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More