A recombinant Escherichia coli strain highly expressing [2fe2s] ferredoxin and its application
A recombinant Escherichia coli and high-efficiency expression technology, which is applied to recombinant Escherichia coli expressing [2Fe2S]ferredoxin with high efficiency and its application field, can solve the problems of high protein price, low expression amount and low activity, and achieves good application prospects , the effect of high expression and yield improvement
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] Example 1: Construction of recombinant Escherichia coli highly expressing [2Fe2S]-type ferredoxin in C.pasteurianum DSM 525
[0035]Take C.pasteurianum DSM 525 cells, and extract genomic DNA from C.pasteurianum DSM 525 cells according to the method recommended by the bacterial genomic DNA extraction kit. According to the known [2Fe2S] type ferredoxin gene sequence in the genome of Clostridium pasteurianum (C.pasteurianum) DSM 525 as shown in SEQ ID NO.1, the primers were designed as follows:
[0036] F Primer: 5'CGCGGATCCGATGGTAAACCCAAAACAC 3'
[0037] R primer: 5' CCCAAGCTTAATTTGAAGTCTTTTAAC 3'
[0038] The extracted C. pasteurianum DSM 525 genomic DNA was used as a template for PCR amplification to obtain [2Fe2S]-type ferredoxin gene. The PCR reaction system is as follows:
[0039]
[0040]
[0041] The PCR reaction conditions are:
[0042] 95℃5min
[0043] 95°C 30s, 55°C 30s, 72°C 30s 30 cycles
[0044] 72℃10min
[0045] 4°C insulation
[0046] After th...
Embodiment 2
[0052] Embodiment 2: the application of recombinant escherichia coli highly expressed [2Fe2S] ferredoxin
[0053] (1) Inoculate the recombinant Escherichia coli strain constructed in Example 1 into the TB medium containing antibiotics and iron-sulfur sources with an inoculum size of 1% by volume, and cultivate it at 37°C and 180rpm for 2 to 3 hours to OD 620nm is 0.6, the bacterial liquid is obtained;
[0054] Among them, the formula and final concentration of components of the above-mentioned TB medium are: Tryptone 12g / L, Yeast extract24g / L, Glycerol 4ml / L, KH 2 PO 4 2.3g / L, K 2 HPO 4 12.5g / L;
[0055] The above-mentioned antibiotics are chloramphenicol with a final concentration of 25 μg / ml, tetracycline with a final concentration of 10 μg / ml, and ampicillin with a final concentration of 100 μg / ml;
[0056] The formula and final concentration of the above-mentioned iron and sulfur sources are: ferric ammonium citrate 0.2-0.3g / L, L-cysteine 0.1-0.2g / L, ferric citrat...
Embodiment 3
[0060] Example 3: Separation, purification and activity determination of [2Fe2S]ferredoxin.
[0061] The purification of protein was carried out in an anaerobic operation box, and all solutions used were degassed and anaerobic treated after boiling.
[0062] Prepare the buffer required for purification: buffer A: sodium phosphate 20mM, NaCl 0.5M, pH 7.4; buffer B: sodium phosphate 20mM, NaCl 0.5M, imidazole 500mM, pH 7.4; the formula of buffer W is: sodium phosphate 50mM, pH 7.4; Buffer W: Sodium Phosphate 50mM, pH 7.0.
[0063] Acquisition of crude enzyme solution: resuspend the frozen cells prepared in Example 2 with buffer A containing 10% glycerol, and use an ultrasonic disruptor to disrupt the cells. The cell disruption procedure is: working time 6 seconds, intermittent time 6 seconds , power 39%, total crushing time is 50 minutes. After the crushing is completed, centrifuge at 12,000 rpm for 30 minutes, take the supernatant and filter it with a 0.22um pore size filter ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com

![A recombinant Escherichia coli strain highly expressing [2fe2s] ferredoxin and its application](https://images-eureka.patsnap.com/patent_img/c69cb396-ca94-442a-9050-a0212187f8e4/HDA0000856459410000011.png)
![A recombinant Escherichia coli strain highly expressing [2fe2s] ferredoxin and its application](https://images-eureka.patsnap.com/patent_img/c69cb396-ca94-442a-9050-a0212187f8e4/HDA0000856459410000012.png)
![A recombinant Escherichia coli strain highly expressing [2fe2s] ferredoxin and its application](https://images-eureka.patsnap.com/patent_img/c69cb396-ca94-442a-9050-a0212187f8e4/BDA0000856459400000031.png)