Recombinant escherichia coli capable of efficiently expressing 2[4Fe4S] ferredoxin and application thereof

A high-efficiency expression technology for recombinant Escherichia coli, which is applied in the direction of bacteria, microorganism-based methods, biochemical equipment and methods, etc., can solve the problems of expensive protein, low expression level, and low activity, and achieve good application prospects and high expression level. High, yield-enhancing effects

Inactive Publication Date: 2016-01-13
SHANDONG UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, only the [2Fe2S] type ferredoxin from spinach is commercially sold. However, due to species differences, this ferredoxin shows different efficiencies when analyzing enzymes from other species, and the protein is very expensive , which largely limits the application of ferredoxin and scientists' research on ferredoxin-related enzymes and metabolic processes
[0003] In the existing literature reports, most ferredoxins are purified from wild bacteria and other organisms, and are also prepared by heterologous expression, but these methods have many shortcomings, such as consuming a lot of time and cumbersome purification steps , low expression, incomplete iron-sulfur cluster assembly of ferredoxin and low activity, low final yield and purity, etc.
Based on this, the research and development of a method capable of efficiently expressing 2[4Fe4S]ferredoxin has become an urgent problem to be solved. After searching, the recombinant Escherichia coli capable of efficiently expressing 2[4Fe4S]ferredoxin and its production in fermentation The application of 2[4Fe4S]ferredoxin has not been reported

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant escherichia coli capable of efficiently expressing 2[4Fe4S] ferredoxin and application thereof
  • Recombinant escherichia coli capable of efficiently expressing 2[4Fe4S] ferredoxin and application thereof
  • Recombinant escherichia coli capable of efficiently expressing 2[4Fe4S] ferredoxin and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1: Construction of recombinant Escherichia coli that highly expresses 2[4Fe4S]-type ferredoxin in C.pasteurianumDSM525

[0035] Take C.pasteurianumDSM525 cells, and extract genomic DNA from C.pasteurianumDSM525 cells according to the method recommended by the bacterial genomic DNA extraction kit. According to the known 2[4Fe4S] type ferredoxin gene sequence in the genome of Clostridium pasteurianum (C.pasteurianum) DSM525 as shown in SEQ ID NO.1, the primers were designed as follows:

[0036] F Primer: 5'CGCGGATCCGATGGCATATAAAATCGCTGA3'

[0037] R primer: 5'CCCAAGCTTTTATTCTTGTACTGGTGCTCC3'

[0038] Using the extracted C. pasteurianum DSM525 genomic DNA as a template, PCR amplification was performed to obtain 2[4Fe4S]-type ferredoxin gene. The PCR reaction system is as follows:

[0039]

[0040]

[0041] The PCR reaction conditions are:

[0042] 95℃5min

[0043] 95°C for 30s, 55°C for 30s, 72°C for 30s and 30 cycles

[0044] 72℃10min

[0045] 4°C insul...

Embodiment 2

[0052] Embodiment 2: the application of recombinant escherichia coli highly expressed 2 [4Fe4S] ferredoxin

[0053] (1) Inoculate the recombinant Escherichia coli strain constructed in Example 1 into the TB medium containing antibiotics and iron-sulfur sources with an inoculum size of 1% by volume, and cultivate it at 37°C and 180rpm for 2 to 3 hours to OD 620nm is 0.6, the bacterial liquid is obtained;

[0054] Among them, the formula and final concentration of components of the above TB medium are: Tryptone12g / L, Yeastextract24g / L, Glycerol4ml / L, KH 2 PO 4 2.3g / L, K 2 HPO 4 12.5g / L;

[0055] The above-mentioned antibiotics are chloramphenicol with a final concentration of 25 μg / ml, tetracycline with a final concentration of 10 μg / ml, and ampicillin with a final concentration of 100 μg / ml;

[0056] The formula and final concentration of the above-mentioned iron and sulfur sources are: ferric ammonium citrate 0.2-0.3g / L, L-cysteine ​​0.1-0.2g / L, ferric citrate 0.18-0.3g / L...

Embodiment 3

[0060] Example 3: Separation, purification and activity determination of 2[4Fe4S]ferredoxin.

[0061] The purification of protein was carried out in an anaerobic operation box, and all solutions used were degassed and anaerobic treated after boiling.

[0062] Prepare the buffer required for purification: buffer A: sodium phosphate 20mM, NaCl0.5M, pH7.4; buffer B: sodium phosphate 20mM, NaCl0.5M, imidazole 500mM, pH7.4; the formula of buffer W is: Sodium phosphate 50mM, pH7.4.

[0063] Acquisition of crude enzyme solution: resuspend the frozen cells prepared in Example 2 with buffer A containing 10% glycerol, and use an ultrasonic disruptor to disrupt the cells. The cell disruption procedure is: working time 6 seconds, intermittent time 6 seconds , power 39%, total crushing time is 50 minutes. After the crushing is completed, centrifuge at 12,000 rpm for 30 minutes, take the supernatant and filter it with a 0.22um pore size filter membrane, and place it on ice as a crude enzy...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses recombinant escherichia coli capable of efficiently expressing 2[4Fe4S] ferredoxin. A strain is named escherichia coli pCodon Plus / pRKISC / pETDuet-2[4Fe4S]Fd, and comprises 2[4Fe4S] ferredoxin genes, and a nucleotide sequence of the strain is shown as SEQ ID NO.1. According to the recombinant escherichia coli, the 2[4Fe4S] ferredoxin genes are connected into a pETDuet-1 carrier, recombinant plasmid is prepared and named pETDuet-2[4Fe4S], the prepared recombinant plasmid is transferred into E.coli C41(DE3) with pCodon Plus and pRKISC plasmid, and recombinant escherichia coli is obtained. The invention further discloses an application of recombinant escherichia coli in fermentation production of 2[4Fe4S] ferredoxin. An experiment proves that 3.7 mg of purified 2[4Fe4S] ferredoxin can be finally obtained through each liter of fermental culture, and is far higher than the yield of 0.5 mg of purified out of wild fungi, and it is indicated that recombinant escherichia coli has good application prospects in industrial production.

Description

technical field [0001] The invention relates to gene recombination engineering bacteria and its application, in particular to a recombinant Escherichia coli highly expressing 2[4Fe4S]ferredoxin and its application. Background technique [0002] Ferredoxin is a kind of acidic protein containing iron-sulfur clusters, and the iron-sulfur clusters are mainly divided into [4Fe4S], [2Fe2S], [3Fe4S] and other types. As a common electron carrier, ferredoxin participates in important metabolic processes such as respiration, photosynthesis, and fermentation. At present, only the [2Fe2S] type ferredoxin from spinach is sold commercially. However, due to species differences, this ferredoxin shows different efficiencies when analyzing enzymes from other species, and the protein is very expensive , which largely limits the application of ferredoxin and scientists' research on ferredoxin-related enzymes and metabolic processes. [0003] In the existing literature reports, most ferredoxin...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N1/21C12P21/02C12R1/19
Inventor王书宁黄海燕胡烈杰于文君袁恒星
OwnerSHANDONG UNIV