Recombinant escherichia coli capable of efficiently expressing 2[4Fe4S] ferredoxin and application thereof
A high-efficiency expression technology for recombinant Escherichia coli, which is applied in the direction of bacteria, microorganism-based methods, biochemical equipment and methods, etc., can solve the problems of expensive protein, low expression level, and low activity, and achieve good application prospects and high expression level. High, yield-enhancing effects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] Example 1: Construction of recombinant Escherichia coli that highly expresses 2[4Fe4S]-type ferredoxin in C.pasteurianumDSM525
[0035] Take C.pasteurianumDSM525 cells, and extract genomic DNA from C.pasteurianumDSM525 cells according to the method recommended by the bacterial genomic DNA extraction kit. According to the known 2[4Fe4S] type ferredoxin gene sequence in the genome of Clostridium pasteurianum (C.pasteurianum) DSM525 as shown in SEQ ID NO.1, the primers were designed as follows:
[0036] F Primer: 5'CGCGGATCCGATGGCATATAAAATCGCTGA3'
[0037] R primer: 5'CCCAAGCTTTTATTCTTGTACTGGTGCTCC3'
[0038] Using the extracted C. pasteurianum DSM525 genomic DNA as a template, PCR amplification was performed to obtain 2[4Fe4S]-type ferredoxin gene. The PCR reaction system is as follows:
[0039]
[0040]
[0041] The PCR reaction conditions are:
[0042] 95℃5min
[0043] 95°C for 30s, 55°C for 30s, 72°C for 30s and 30 cycles
[0044] 72℃10min
[0045] 4°C insul...
Embodiment 2
[0052] Embodiment 2: the application of recombinant escherichia coli highly expressed 2 [4Fe4S] ferredoxin
[0053] (1) Inoculate the recombinant Escherichia coli strain constructed in Example 1 into the TB medium containing antibiotics and iron-sulfur sources with an inoculum size of 1% by volume, and cultivate it at 37°C and 180rpm for 2 to 3 hours to OD 620nm is 0.6, the bacterial liquid is obtained;
[0054] Among them, the formula and final concentration of components of the above TB medium are: Tryptone12g / L, Yeastextract24g / L, Glycerol4ml / L, KH 2 PO 4 2.3g / L, K 2 HPO 4 12.5g / L;
[0055] The above-mentioned antibiotics are chloramphenicol with a final concentration of 25 μg / ml, tetracycline with a final concentration of 10 μg / ml, and ampicillin with a final concentration of 100 μg / ml;
[0056] The formula and final concentration of the above-mentioned iron and sulfur sources are: ferric ammonium citrate 0.2-0.3g / L, L-cysteine 0.1-0.2g / L, ferric citrate 0.18-0.3g / L...
Embodiment 3
[0060] Example 3: Separation, purification and activity determination of 2[4Fe4S]ferredoxin.
[0061] The purification of protein was carried out in an anaerobic operation box, and all solutions used were degassed and anaerobic treated after boiling.
[0062] Prepare the buffer required for purification: buffer A: sodium phosphate 20mM, NaCl0.5M, pH7.4; buffer B: sodium phosphate 20mM, NaCl0.5M, imidazole 500mM, pH7.4; the formula of buffer W is: Sodium phosphate 50mM, pH7.4.
[0063] Acquisition of crude enzyme solution: resuspend the frozen cells prepared in Example 2 with buffer A containing 10% glycerol, and use an ultrasonic disruptor to disrupt the cells. The cell disruption procedure is: working time 6 seconds, intermittent time 6 seconds , power 39%, total crushing time is 50 minutes. After the crushing is completed, centrifuge at 12,000 rpm for 30 minutes, take the supernatant and filter it with a 0.22um pore size filter membrane, and place it on ice as a crude enzy...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 
