Method for joint production of 1,3-propanediol and glutamic acid by recombinant Corynebacterium glutamicum
A technology of Corynebacterium glutamicum and propylene glycol, applied in microorganism-based methods, biochemical equipment and methods, bacteria and other directions, can solve the problems of low glucose quality yield, complicated post-extraction process, low yield and the like, and achieve separation Process simplification, resolution of biosafety, effect of less by-products
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0030] The recombinant plasmid pEC-dhaT-pdu overexpressing 1,2-propanediol dehydratase and its activator and 1,3-propanediol dehydrogenase gene was constructed.
[0031] The genome of Klebsiella pneumoniae HR526 was used as a template, and the primers pdu-F (tgcctgcaggtcgactctagTTAAGCATGGCGATCCCGAAATGG) and pdu-R (CGCCCGCtaaAAGGAGATATACCATGAGATCGAAAAGATTTGAAG) were used as primers for PCR to obtain the pduCDEGH operon including 1,2-propanediol dehydratase and its activator Fragment (pduCDEGH sequence shown in SEQ ID NO.2) and PCR product purification (Tiangen biological PCR product purification kit). With the genome of Klebsiella pneumoniae HR526 as template, with primers dhaT-F (ATATCTCTTttaGCGGGCGGCTTCGTATA) and dhaT-R (ctatgacatgattacgaattAAGGAGATATACCatgAACAACTTTAATCTGCAC) as primers, PCR is carried out to obtain 1,3-propanediol dehydrogenase gene dhaT fragment (sequence such as SEQ ID NO.1) and purified (Tiangen Biological PCR Product Purification Kit). The Escherichia c...
Embodiment 2
[0033] Knockout of the lactate dehydrogenase gene ldhA.
[0034]Using the genome of Corynebacterium glutamicum ATCC13032 as a template, PCR was carried out with primers ldhA-up-F (ctatgacatgattacgaattAAAACAGCCAGGTTAGCAGCC) and ldhA-up-R (CGCCAAAGATTTTCGATCCCACTTCCTGATTTCCC) to obtain a homologous fragment ldhA-up about 500 bp upstream of ldhA and carry out PCR product purification. Using the genome of Corynebacterium glutamicum ATCC13032 as a template, PCR was performed with primers ldhA-down-F (GGGATCGAAAATCTTTGGCGCCTAGTTGGC) and ldhA-up-R (ccgggtaccgagctcgaattGAGAATTTCGGCGTGCTCG) as primers, and a homologous fragment ldhA-down about 500 bp downstream of ldhA was obtained and carried out PCR product purification. The Corynebacterium glutamicum suicide plasmid pK18mobsacB (Journal of Biotechnology 104 (2003) 287-299) was single-digested with EcoRI, and the ldhA-up and ldhA-down fragments were connected to pK18mobsacB in one step using the GibsonAssembly kit (NEB) , and the o...
Embodiment 3
[0036] Construction of recombinant Corynebacterium glutamicum expressing 1,2-propanediol dehydratase and its activator and 1,3-propanediol dehydrogenase gene.
[0037] Using an electroporator (Bio-Rad), pEC-dhaT-pdu was transferred into the wild Corynebacterium glutamicum ATCC 13032 and the recombinant bacterium C. glutamicum ΔldhA knocked out of lactate dehydrogenase ldhA by electroporation, and the electric shock condition was a voltage of 2.5 KV, resistance 600Ω, capacitance 25μF (shock cup width 2mm). The recombinant strains were screened on LB plate containing 25 mg / L kanamycin, and named as C. glutamicum / pEC-dhaT-pdu and C. glutamicum ΔldhA / pEC-dhaT-pdu respectively.
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap