Preparation method of allogenic mesenchymal stem cells by CRISPR (clustered regularly interspaced short palindromic repeats) technique editing and IGF (insulin-like growth factor) optimization and application of allogenic mesenchymal stem cells in treating myocardial infarction

A mesenchymal stem cell and allogeneic technology, applied in the field of allogeneic mesenchymal stem cells, can solve the problems that cell transplantation therapy is difficult to take effect, patients have no time to prepare MSCs, and myocardial infarction is urgent, so as to improve the ability of anti-apoptosis, save money, and promote regression. nest effect

Active Publication Date: 2016-10-05
SUZHOU UNIV
View PDF4 Cites 48 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Scar tissue formed after 2 weeks, making it difficult for cell transplantation to work
[0005] Currently used autologous MSCs transplantation to treat myocardial infarction is a technology that has emerged and developed rapidly in recent years, but it also has the following defects: 1) The onset of myocardial infarction is generally relatively urgent, and patients may not have time to prepare their own MSCs, and most myocardial infarctions happens to older people
Studies have shown that with the increase of age, the number of MSCs in the body decreases, and the cell viability gradually decreases, so new cell transplantation techniques are needed, such as the present invention: allogeneic MSCs without immune rejection, anti-apoptosis, and easy to homing 2) Compared with the CRISPR / Cas9 technology used in the present invention, the traditional siRNA technology has a relatively low transfection efficiency and cannot completely knock out the target gene.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method of allogenic mesenchymal stem cells by CRISPR (clustered regularly interspaced short palindromic repeats) technique editing and IGF (insulin-like growth factor) optimization and application of allogenic mesenchymal stem cells in treating myocardial infarction
  • Preparation method of allogenic mesenchymal stem cells by CRISPR (clustered regularly interspaced short palindromic repeats) technique editing and IGF (insulin-like growth factor) optimization and application of allogenic mesenchymal stem cells in treating myocardial infarction
  • Preparation method of allogenic mesenchymal stem cells by CRISPR (clustered regularly interspaced short palindromic repeats) technique editing and IGF (insulin-like growth factor) optimization and application of allogenic mesenchymal stem cells in treating myocardial infarction

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0053] Example 1. Isolation of human umbilical cord blood mesenchymal stem cells:

[0054] 1) The umbilical cord blood of fetuses delivered by vaginal delivery and cesarean section was collected under sterile conditions, and anticoagulated with heparin.

[0055] 2) Immediately after the specimen collection, the cord blood was diluted with PBS at a ratio of 1:1.

[0056] 3) Slowly add the diluted blood to an equal volume of lymphocyte separation solution, and the addition should be slow, taking care not to break through the stratification between the liquids, and centrifuge at 1000r / min for 15min.

[0057] 4) Carefully absorb the buffy coat layer at the middle interface, wash twice with PBS, suspend the cells in serum-free human mesenchymal stem cell (hMSC) medium to make a single cell suspension, and use 5×10 6 / mL density inoculation, placed at 37°C, 5% CO 2 cultured in an incubator.

[0058] 5) Change the medium after 7 days to remove non-adherent cells, and subculture af...

Embodiment 2

[0059] Example 2. Identification of human umbilical cord blood mesenchymal stem cells

[0060] 1) The 3rd passage cells in good growth state were taken and digested with 0.25% trypsin. The digested cells were centrifuged, resuspended in PBS, and counted.

[0061] 2) Adjust the cell concentration to 1×10 6 / ml, pipette 100μl into each EP tube, that is, 1×10 5 cells. Add fluorescein-labeled CD90-FITC (USA eBioscience, Cat. # : 11-0909 -41), CD45-FITC (eBioscience, USA, Cat. # : 11-9459-41), CD11b-PE (USA eBioscience, Cat # :12-0113-41).

[0062] 3) After incubating in the dark for 30 minutes, wash twice with PBS, and perform flow cytometry detection. The detection results are as follows: figure 2 , the abscissa indicates the fluorescence intensity, and the ordinate indicates the number of cells detected by flow cytometry.

Embodiment 3

[0063] Example 3 Design of target molecules B2M-gRNA and TNF-α-gRNA edited by mesenchymal stem cells

[0064] 1) Find the exons of the B2M gene from the ENSEMBL website, and find that the gene has 14 transcripts in total, but only 3 transcripts can encode proteins, namely B2M-001, B2M-006, and B2M-201.

[0065] 2) After comparing the three transcripts of B2M-001, B2M-006 and B2M-201, it was found that they have a common exon - ENSE00002219576. The sequence for ENSE00002219576 is as follows:

[0066] ENSE00002219576:

[0067] CCGACATTGAAGTTGACTTACTGAAGAATGGAGAGAGAATTGAAAAAGTGGAGCATTCAGACTTGTCTTTCAGCAAGGACTGGTCTTTCTATCTCTTGTACTACACTGAATTCACCCCCACTGAAAAAGATGAGTATGCCTGCCGTGTGAACCATGTGACTTTGTCACAGCCCAAGATAGTTAAGTGGG

[0068] 3) Input the exon into the "OPTIMISED" website to obtain DNA oligo sequences corresponding to 14 candidate gRNAs, and screen and select the oligo sequence AGTCACATGGTTCACACGGCAGG with a relatively high score. (Such as image 3 )

[0069] 4) Using the same ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of allogenic mesenchymal stem cells, and particularly relates to a preparation method of allogenic mesenchymal stem cells by CRISPR (clustered regularly interspaced short palindromic repeats) technique editing and IGF (insulin-like growth factor) optimization and application of the allogenic mesenchymal stem cells in treating myocardial infarction. The preparation method comprises the following steps: carrying out separation by density gradient centrifugation to obtain allogenic single karyocytes, and carrying out adherent culture to obtain mesenchymal stem cells; designing a mesenchymal stem cell surface antigen B2M-gRNA and an inflammatory factor TNF-alpha-gRNA; establishing recombinant slow virus particles, and transfecting the mesenchymal stem cells; optimizing the mesenchymal stem cells by using IGF-1; and preparing drugs for treating myocardial infarctions by using the modified and optimized mesenchymal stem cells. The CRISPR / Cas9 technique is utilized to remove the antigens capable of causing immunological rejection and the inflammatory factors capable of causing inflammatory reaction on the mesenchymal stem cell surface, and the IGF-1 is utilized to enhance the apoptosis resistance of the mesenchymal stem cells and promote the homing of the mesenchymal stem cells, thereby providing a new technical scheme for preparing drugs for treating cardiovascular diseases in clinic. The prepared allogenic mesenchymal stem cells can not cause immunological rejection after cell transplantation.

Description

technical field [0001] The invention belongs to the application field of allogeneic mesenchymal stem cells, and specifically relates to a preparation method of allogeneic mesenchymal stem cells edited by CRISPR / Cas9 technology and optimized by growth factors and its application in the treatment of myocardial infarction. Background technique [0002] With the development of society and economy, profound changes have taken place in the way of life of the people, especially the aging of the population and the acceleration of urbanization, the risk factors of cardiovascular disease in China have shown a clear upward trend, resulting in a continuous increase in the number of cardiovascular diseases. Among them, the mortality rate of acute myocardial infarction (AMI) is also on the rise. Acute myocardial infarction is one of the common clinical emergencies with high mortality and poor prognosis, which has caused serious harm to people's health. At the same time, the incidence of ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/867A61K35/28A61P9/10
CPCA61K35/28C12N15/86C12N2740/15043
Inventor李杨欣沈振亚邵联波
OwnerSUZHOU UNIV