1213 results about "First myocardial infarction" patented technology

Various systems, devices, and methods are disclosed herein for treating acute myocardial infarction (AMI) patients using a heart pump controlled in a manner that maximizes mechanical unloading of the left ventricle in the presence of cardiovascular instability and minimizes myocardial oxygen consumption (MVO2) and consequentially infarct size to prevent the development of subsequent heart failure. In a closed feedback system, the system can include a sensor configured to generate an output used to measure or calculate a left ventricular systolic pressure (LSVP) within the left ventricle of a heart and a controller coupled to a heart pump. The controller can be configured to measure or calculate the LVSP based on the output of the sensor and to control an operation of the heart pump to maximize mechanical unloading of the left ventricle based on the measured or calculated LVSP.

The invention provides a prognosis risk prediction model construction method based on coexistence of acute myocardial infarction and atrial fibrillation and application. The method comprises the following steps: S1, acquiring historical patient clinical information of a target patient and death time after coexistence of diseases; s2, preprocessing clinical information of historical patients; s3, using an LASSO method and a ten-fold cross validation method to identify related clinical features related to death time after coexistence of diseases; s4, dividing a training set and a verification set; s5, performing training optimization on the four machine models by using the training set, evaluating the prediction performance of the models by using the verification set, and determining a Glmnet model with the optimal prediction performance; and S6, performing model interpretation on the Glmnet model by using an SHAP value, and determining an optimal prediction factor of which the model prediction contribution ranks the first three. The prognosis risk of coexistence of acute myocardial infarction and atrial fibrillation can be accurately predicted, and reference is provided for clinical diagnosis and treatment of patients with coexistence of acute myocardial infarction and atrial fibrillation.

Systems for delivering a device for regulating blood pressure across a patients atrial septum are provided. The delivery apparatus may include a first catheter, a hub having one or more engagers disposed thereon, the one or more engagers configured to releasably engage with a first expandable end of the shunt in a contracted delivery state within a lumen of a sheath, and an second catheter extending through a center lumen of the first catheter and the hub, wherein the first catheter, the hub, and the second catheter are independently moveable relative to the sheath. The inventive devices may reduce left atrial pressure and left ventricular end diastolic pressure, increase cardiac output, increase ejection fraction, relieve pulmonary congestion, and lower pulmonary artery pressure, among other benefits. The inventive devices also may be used to treat subjects having heart failure, pulmonary congestion, or myocardial infarction, among other pathologies.

The invention provides a myocardial infarction positioning method based on cross-modal knowledge fusion. The method comprises the following steps: acquiring a target 1D-VCG signal and constructing a 2D-VCG image data set; extracting spatial features, time sequence features and pseudo tags from the 2D-VCG signals and the 1D-VCG signals through a teacher model and a student model; aligning and transforming the spatial features and the time sequence features through a cross-modal generator; and cross-modal knowledge fusion and MI positioning are realized through a cross-modal generator. According to the method, through knowledge enhancement and student enhancement strategies, the accuracy of myocardial infarction positioning is improved, and the overall framework of cross-modal learning is optimized through the adaptive weight method; the method is realized in a knowledge distillation form, spatial features of 2D-VCG are successfully fused into 1D-VCG time sequence analysis, and the positioning accuracy of myocardial infarction is remarkably improved by combining cooperative work of a teacher model, a student model and a cross-modal generator.

Method and systems are described that create a 3D reconstruction of a vessel of interest that represents a subset of a coronary tree that includes a lesion; calculate at least one of pressure parameters or anatomical parameters based at least in part on a portion of the 3D reconstruction that includes the lesion; calculate a wall shear stress (WSS) descriptor, based on the 3D reconstruction, for a segment of a surface of the vessel that includes the lesion, wherein the WSS descriptor includes information regarding an amount of variation in contraction or expansion applied at surface elements within the segment during at least a portion of a cardiac cycle; and calculate a myocardial infarction (MI) index based on the WSS descriptor and the at least one of the pressure or anatomical parameters, the MI index representing a likelihood that the lesion will result in an MI.

The invention relates to the technical field of model construction, in particular to a construction method and system of a myocardial infarction patient risk assessment model. The method comprises the following steps: carrying out sign data acquisition and coronary artery angiography image acquisition on a myocardial infarction patient through a medical information system, carrying out electrocardiosignal-vascular movement mapping processing according to the coronary artery angiography image of the myocardial infarction patient, and meanwhile, carrying out blocked electrocardiosignal pre-gradient feedback identification; blocking electrocardio pre-gradient feedback data is obtained; carrying out electrocardiosignal phase offset analysis on the obstructed electrocardiosignal pregradient feedback data, and constructing a myocardial infarction patient risk assessment model to obtain the myocardial infarction patient risk assessment model; and performing automatic monitoring firmware design on the myocardial infarction patient risk assessment model to obtain myocardial infarction patient risk assessment model monitoring firmware. The myocardial infarction patient risk assessment model construction technology is optimized, so that the assessment model construction technology is more perfect.

The invention relates to a myocardial injury risk assessment method and device, computer equipment and a storage medium. The method comprises the following steps: acquiring and analyzing a resting electrocardiosignal to obtain a high-frequency QRS envelope curve and a resting low-frequency electrocardiosignal; analyzing the high-frequency QRS envelope curve to obtain a resting high-frequency QRS feature including a resting positive lead number, a resting critical lead number, a first target lead number, a second target lead number, a third target lead number and a high-frequency form index; the first target lead number refers to a lead number of which the wave crest number is greater than or equal to a first number threshold; the second target lead number refers to the lead number with the wave crest number equal to the second number threshold value; the third target lead number refers to the number of leads of which the crest number is equal to a third number threshold; the resting low-frequency electrocardiosignals are analyzed to obtain resting low-frequency characteristics such as old myocardial infarction information; and analyzing the myocardial injury risk assessment feature set comprising the resting high-frequency QRS feature and the resting low-frequency feature to obtain a myocardial injury risk assessment score.

The invention belongs to the technical field of medical image recognition, and particularly discloses a myocardial infarction complication recognition method based on a heart multi-modal image, and the method comprises the steps: firstly obtaining multi-modal medical image data and corresponding diagnosis report text data; constructing a myocardial infarction complication identification model; dividing the whole network into a feature extraction stage and an image text feature matching stage by adopting a separation training thought, carrying out back propagation on the network in the feature extraction stage through L1 loss, and optimizing weight parameters of the feature extraction network; performing back propagation on the network in the image text matching stage by comparing loss, and optimizing parameters of an image and a text encoder; and finally, collecting a medical image of the heart of a patient, inputting the medical image into the trained myocardial infarction complication identification model, and generating a character diagnosis report of heart disease complication. Therefore, early automatic diagnosis of myocardial infarction complications is realized.

The invention discloses a myocardial infarction patient risk assessment model construction method and system, and particularly relates to the field of cardiovascular disease prediction, and the method comprises the following steps: I, collecting modal data of a hospital information system, an image filing system and wearable equipment, and integrating the modal data; according to the method, the accuracy of myocardial infarction risk prediction can be optimized, risk assessment not only depends on statistical characteristics, but also fuses pathophysiological mechanisms, the clinical interpretability of prediction is improved, the limitation that a traditional data-driven method is only based on correlation modeling is avoided, the optimal treatment scheme can be dynamically adjusted, data-driven personalized medical treatment is achieved, and the risk assessment efficiency is improved. The scientificity of intervention decision making is improved; the method can quickly adapt to new patient data, improve the individualized prediction ability, improve the data utilization rate, enhance the generalization ability of the model for different patient groups, avoid training the whole model from zero, greatly reduce the consumption of computing resources, make up for the problem of insufficient data of a single patient, and improve the prediction ability of rare cases.

The invention discloses application of an RNF130 activator in preparation of a medicine for preventing and / or treating ischemic heart disease, and belongs to the technical field of biological medicine. Research results show that when an RNF130 activator is given in a mouse of a myocardial ischemia reperfusion injury model, the left ventricular ejection fraction and the left ventricular short-axis shortening rate of the mouse can be improved, myocardial tissue pathological injury can be relieved, the protein expression levels of NOX-2, BAX and TNF-alpha are reduced, the myocardial infarction area is reduced, and myocardial cell apoptosis is reduced; therefore, the RNF130 activator has prevention and treatment effects on the myocardial ischemia-reperfusion injury, that is, the RNF130 activator can be used as an effective component of the medicine for preventing or treating diabetes complicated by myocardial ischemia-reperfusion injury, and a new strategy is provided for preparation of the medicine for preventing and treating myocardial ischemia-reperfusion injury.

A class of compounds and the use thereof in a drug. Specifically, the present invention relates to a class of new compounds, a pharmaceutical composition containing the compounds, a method for preparing the compounds, and the use of the compounds or the pharmaceutical composition in the preparation of a drug for treating GLP-1 receptor agonist-mediated diseases and / or disorders, particularly the use in the preparation of a drug for treating diabetes, non-alcoholic fatty liver disease, obesity, myocardial infarction, heart failure, diabetic nephropathy, Parkinson's disease and Alzheimer's disease.

The invention discloses a myocardial infarction risk assessment method, system and equipment based on multi-modal interpretability. The method comprises the following steps: constructing a dynamic weighted fuzzy cognitive map model for myocardial infarction risk assessment; inputting the aggregated feature vector into a dynamic weighted fuzzy cognitive map model, updating the activation value of each concept node by adopting the finely-adjusted weight and the activation function until a preset condition is met to obtain a final activation value of each concept node, and taking the final activation value of the myocardial infarction risk concept node as a myocardial infarction risk assessment result; calculating the contribution degree of each physiological index in the aggregated feature vector according to a myocardial infarction risk assessment result; searching a maximum influence propagation path from each source node to the target node to obtain at least one maximum influence propagation path; and constructing an interpretable myocardial infarction risk assessment report based on the contribution degree of each physiological index and the at least one maximum influence propagation path. According to the invention, interpretable and high-precision model evaluation is realized.

The invention relates to hydrogel loaded with oxygen self-producing nanoparticles as well as a preparation method and application of the hydrogel. The preparation method comprises the following steps: 1, taking cross-linked methacrylamide silk fibroin and hyaluronic acid modified by arginine-glycine-aspartic acid peptide as base materials, and loading self-oxygen-producing nano particles CaO2 (at) PVP (at) Cu-EGCG, and the self-oxygen-producing nano particles CaO2 (at) PVP (at) Cu-EGCG are prepared by coating Cu-EGCG on calcium peroxide nano particles modified by PVP modified polyvinylpyrrolidone. The hydrogel can improve energy metabolism and regulate immune environment through dual mechanisms, realizes efficient promotion of myocardial repair, and provides a new strategy and thought for tissue regeneration and functional recovery after myocardial infarction.

The invention discloses application of chrysin-7-0-beta-D-glucuronide in treatment of ischemic heart disease or an LRP6 inhibitor, and belongs to the technical field of treatment of ischemic heart disease. The invention provides a new application of a small molecular compound chrysin-7-0-beta-D-glucuronide, the compound realizes regulation and control on a cardiac muscle cell cycle by inhibiting LRP6, and finally promotes repair of cardiac muscle cells and inhibits apoptosis. According to the invention, by exploring the function of inhibiting LRP6 protein of a small molecule drug, a powerful repair reaction is guided after myocardial ischemia reperfusion, so that effective treatment of myocardial infarction is realized. Therefore, finding of an LRP6 inhibitor not only has a potential curative effect on promoting myocardial cells to enter a cell cycle, but also has important significance on treatment of MI.

The embodiment of the invention provides a three-stage feature enhanced myocardial infarction positioning method, which belongs to the technical field of medicine, and specifically comprises the following steps: sampling original electrocardiogram data at a preset sampling rate; performing data enhancement on the sample data set to obtain a training set; performing first-stage training of the initial model by using the training set to generate a lead contribution diagram; performing initial model two-stage training by using the minority class samples and the lead contribution diagram, updating initial model parameters, and freezing part of network parameters of a backbone network in the initial model; performing three-stage training of an initial model by using the training set and the lead contribution graph, performing back propagation by using a weighted dichotomy cross entropy loss function to update network parameters of a graph time-space cross attention network in the initial model, and forming a target model in combination with a trained backbone network and a multi-branch classification structure; and inputting the target electrocardiogram data into the optimized target model to obtain a positioning result. Through the scheme of the invention, the positioning accuracy and robustness are improved.

The invention belongs to the field of biological medicines, and particularly discloses application of DNAJB6 in preparation of medicines for preventing or treating myocardial infarction (MI). In-vivo and in-vitro experiments find that the expression of DNAJB6 protein in an MI model is remarkably reduced, and the over-expression of DNAJB6 can improve the cardiac function of a mouse after MI, relieve myocardial fibrosis and inhibit hypoxia-induced myocardial apoptosis; and cell apoptosis is aggravated by low expression of DNAJB6. The overexpression of the DNAJB6 by using the myocardial specific adeno-associated virus (AAV) can be used as a new strategy for preventing and treating the MI, and an experimental basis is provided for developing a drug for targeting the DNAJB6.

The invention discloses an application of a biomarker in preparation of a kit for a prognosis risk early warning method of an acute ST segment elevation type myocardial infarction patient. The biomarker comprises an HBP (Hepatitis Binding Protein). By monitoring the change of the HBP protein level, whether a patient suffering from the acute ST segment elevation type myocardial infarction has poor prognosis within 30 days after a PCI operation can be effectively evaluated, so that early recognition and timely clinical intervention on high-risk patients are realized, the treatment response speed and effect are improved, the occurrence rate of adverse cardiovascular events is reduced, and the treatment effect of the patient suffering from the acute ST segment elevation type myocardial infarction is improved. And the prognosis of the patient is finally improved.

The invention is applicable to the technical field of biological detection, provides a fluorescence immunochromatography detection method based on monatomic nano-enzyme enhancement, and particularly relates to two application forms: in the first form, a detection signal enhanced fluorescence immunochromatography detection card and a sample diluent containing a monatomic nano-enzyme are involved; in the second form, the invention relates to a fluorescence immunochromatography detection card with enhanced detection signals, and a sample pad of the detection card is obtained by soaking a sample pad treatment solution containing a monatomic nano-enzyme solution. The two application forms both relate to a monatomic nano-enzyme solution, and the solution is composed of monatomic nano-enzyme, bio-enzyme composite microspheres, a protective agent, a surfactant, a thickening agent and a preservative. The monatomic nano enzyme is composed of an atomic-scale dispersed metal active center and a carrier material. When the method is used for detecting myocardial and inflammatory markers, the limit of quantitation can reach the pg / mL level, the detection linear range can span three orders of magnitude, and the clinical examination use requirements can be met. The kit can be applied to rapid quantitative detection of myocardial and inflammatory markers, has the advantages of high sensitivity, rapidness, convenience and high efficiency, and provides an auxiliary diagnosis basis for early screening of myocardial infarction, heart failure and infection related diseases.

An isolated nucleic acid that includes the nucleotide sequence: CGUCCGAUGGUAGUGGGUUAUCAG (SEQ ID NO: 12) is provided. In some embodiment, the nucleic acid includes at least one chemically-modified nucleotide. The nucleic acid and composition containing same find use in treating conditions associated with inflammation and / or fibrosis, for example, without limitation, heart conditions, such as hypertrophic myocardiopathy, myocardial infarction, and heart failure with preserved ejection fraction; muscle disorders, such as muscular dystrophy; skin disorders, such as scleroderma; and inflammatory conditions, such as autoimmune conditions or inflammatory conditions associated with a viral infection.

In alternative embodiments, provided are methods for treating, ameliorating, lessening the symptoms of, or preventing, angina, myocardial infarction, reperfusion injury, ventricular arrhythmias (VA), pump failure due to myocardial infarction (MI) in an early ischemia / reperfusion (I / R) period, and / or congestive heart failure (CHF) comprising administering to an individual in need thereof a composition or a drug capable of suppressing hypoxia-induced SUMOylation of the cardiac sodium channel NaV1.5.

Systems and methods for delivering a device for regulating blood pressure across a patient's atrial septum are provided. The delivery apparatus may include a first catheter, a hub having one or more engagers disposed thereon, the one or more engagers configured to releasably engage with a first expandable end of the shunt in a contracted delivery state within a lumen of a sheath, and an second catheter extending through a center lumen of the first catheter and the hub, wherein the first catheter, the hub, and the second catheter are independently moveable relative to the sheath. The inventive devices may reduce left atrial pressure and left ventricular end diastolic pressure, increase cardiac output, increase ejection fraction, relieve pulmonary congestion, and lower pulmonary artery pressure, among other benefits. The inventive devices also may be used to treat subjects having heart failure, pulmonary congestion, or myocardial infarction, among other pathologies.

Provided are novel prodrug salts of selective aquaporin inhibitors, their use as pharmaceuticals, and pharmaceutical compositions comprising them, and novel processes for their synthesis and novel intermediates for use in their synthesis. Also provided is use of a compound for the prophylaxis, treatment, and control of aquaporin-mediated conditions. Aquaporin inhibitors, e.g., inhibitors of AQP4 and / or AQP2, may be of utility in the treatment or control of diseases of water imbalance, for example edema (particularly edema of the brain and spinal cord), hyponatremia, and excess fluid retention, as well as diseases such as epilepsy, retinal ischemia and other diseases of the eye, myocardial ischemia, myocardial ischemia / reperfusion injury, myocardial infarction, myocardial hypoxia, congestive heart failure, sepsis, and neuromyelitis optica, as well as migraines.

Provided herein are stable lisinopril oral liquid formulations. Also provided herein are methods of using lisinopril oral liquid formulations for the treatment of certain diseases including hypertension, heart failure and acute myocardial infarction.

Machine-based risk prediction or assistance is provided for perioperative complications, such as perioperative myocardial infarction (PMI). Machine learning models are used to predict the risk of PMI and / or recommend a course of action to avoid PMI in PCI. In the prediction, various combinations of types or modes of information are used, such as both imaging and non-imaging data. Machine learning models can be used to make predictions before, during, and / or after PCI to reduce the chance of PMI more quickly. Workflows for pre-PCI, during PCI, and / or post-PCI incorporate risk predictions and / or risk-based recommendations to reduce PMI in patients.

The invention belongs to the field of compositions of biomedical materials and high-molecular compounds, and provides hydrogel capable of regulating and controlling the redox steady state of a microenvironment as well as a preparation method and application of the hydrogel. A macromolecular network of the hydrogel capable of regulating and controlling the redox steady state of the microenvironment is formed by catechol modified hyaluronic acid, carboxylated chitosan, oxidized dextran and iron ions through a hybridization cross-linking reaction; under physiological conditions, catechol groups in the hydrogel can be subjected to an autoxidation reaction to generate H2O2, and meanwhile, iron ions coordinated on the catechol groups in the hydrogel can catalytically decompose H2O2 into water and oxygen, so that the level of active oxygen in a microenvironment is adjusted. The hydrogel disclosed by the invention can realize bidirectional regulation and control on active oxygen in a pathological microenvironment after myocardial infarction, so that the redox steady state of the pathological microenvironment after myocardial infarction is maintained, and the regeneration and repair capacity of an existing hydrogel material with antioxidant capacity on myocardial tissues after myocardial infarction is improved.

The invention discloses an application of rilpivirine (RPV) in preparation of a medicine for treating myocardial infarction, and relates to the field of medicines for treating myocardial infarction. The invention belongs to the technical field of biological medicine. According to the present invention, the acute myocardial infarction (AMI) disease mouse model is constructed through the induction of the permanent ligation of the left anterior descending branch; after rilpivirine is orally taken, the conditions of survival, heart function, structure change and the like of the AMI mouse model during X weeks after operation are observed. Results show that rilpivirine (as shown in the formula I) has the effects of remarkably improving the cardiac function of AMI injury, relieving cardiac remodeling and increasing the survival rate of AMI mice. Therefore, a new technical means is provided for treatment of myocardial infarction, and rilpivirine has a wide application prospect in treatment of myocardial infarction diseases. # imgabs0 #

The invention relates to the field of medicine synthesis, and discloses a GCG-GLP-1 dual agonist compound. The GCG-GLP-1 dual-agonist compound provided by the invention is used for preparing a pharmaceutical composition for treating diseases, and the application of the pharmaceutical composition in preparing a medicine for treating at least one of the following diseases, the diseases include type II diabetes mellitus, impaired glucose tolerance, type I diabetes mellitus, obesity, hypertension, metabolic syndrome, dyslipidemia, cognitive impairment, atherosclerosis, myocardial infarction, coronary heart disease, cardiovascular disease, stroke, inflammatory bowel syndrome and / or dyspepsia or gastric ulcer, hepatic fibrosis disease and pulmonary fibrosis disease.

The present invention relates to monoclonal antibodies, or fragments thereof, which bind to MYBPC3 (Myosin binding protein C, cardiac type). Further, the present invention relates to a kit comprising the monoclonal antibodies of the present invention. In some embodiments, the kit is provided as sandwich assay. Further the present invention relates to the in vitro use of the monoclonal antibodies, or fragments thereof, or of the kit of the present invention for the detection of MYBPC3 in a sample. Moreover, the present invention relates to diagnostic methods, such as the assessment of cardiac condition, for example of myocardial infarction.

The invention relates to the field of medicine synthesis, and discloses a GLP-1 / GIP / GCG tri-agonist compound. The GLP-1 / GIP / GCG three-agonist compound is used for preparing a medicine composition for treating diseases, and the application of the medicine composition in preparing a medicine for treating at least one of the following diseases, namely, the GLP-1 / GIP / GCG three-agonist compound, and the GLP-1 / GIP / GCG three-agonist compound. The diseases include type II diabetes mellitus, impaired glucose tolerance, type I diabetes mellitus, obesity, hypertension, metabolic syndrome, dyslipidemia, cognitive impairment, atherosclerosis, myocardial infarction, coronary heart disease, cardiovascular disease, stroke, inflammatory bowel syndrome and / or dyspepsia or gastric ulcer, hepatic fibrosis disease and pulmonary fibrosis disease.

The invention discloses an acute myocardial infarction diagnosis method based on interpretable hybrid ensemble learning. The specific implementation process is as follows: performing data preprocessing on collected original chest pain data; the adaptability of a single basic algorithm is enhanced through nested iterative optimization and global hyper-parameter tuning; dynamic multi-strategy integration is utilized to select an optimal integration strategy, and layered feature abstraction, probability calibration fusion and a consensus decision mechanism are included; in order to improve clinical transparency, a game theory marginal contribution analysis framework is constructed, and SHAP values of global and local feature contributions are quantified; collaboratively optimizing data-driven feature dimension reduction and clinical knowledge verification on the basis of SHAP value ranking, screening out six key clinical features, and constructing a hybrid integrated learning model; the method is further used for STEMI, NSTEMI and non-AMI diagnosis, and the complex diagnosis adaptability of the method is verified. According to the method, algorithm diversity and clinical transparency are integrated, and effective acute myocardial infarction diagnosis is realized.