A primer, kit and identification method for identifying red sea bream, black sea bream and their hybrid offspring
A kit, the technology of black sea bream, is applied in the directions of biochemical equipment and methods, microbial determination/inspection, DNA/RNA fragments, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0043] A total of 24 samples of 8 red sea bream, 8 black sea bream and their hybrid offspring were collected from the Lvsi base of Jiangsu Institute of Oceanography and Fisheries. Take 30 μL of blood cells from each fish to extract genomic DNA, and use the extracted genomic DNA as a template for PCR amplification. The sense primer is: 5′GACGATTATGATGATGGCCACTGAAC 3′ (SEQ ID NO.1), and the antisense primer is: 5′ CTCCCCATCCACCTGGACGAC 3′ (SEQ ID NO.2), the total volume of the PCR system is 20 µL, which contains 1× reaction buffer, Mg 2+ 2 mmol / L, dNTP 200 μmol / L, upstream and downstream primers 0.2 μmol / L, Taq enzyme 0.5 U, DNA template 100 ng-200 ng, make up the volume with sterile double distilled water. The PCR reaction conditions were: 94°C for 2 min; 30 cycles of 94°C for 40 s, 60°C for 40 s, 72°C for 40 min, 30 cycles; 72°C for 5 min, and 4°C for storage. After the PCR reaction was finished, 7 μL of the PCR reaction product was taken from each sample and detected by ele...
Embodiment 2
[0045] 12 red sea breams to be checked, 6 red sea bream hybrids and black sea bream hybrids were used as a comparison, the tail fins of each fish were clipped and genomic DNA was extracted, and PCR amplification, detection, and re-amplification were carried out as described in Example 1. Enzyme digestion, the digested products were electrophoresed with 3% agarose to take pictures and record the electrophoresis results. Such as figure 2 The electrophoresis test shown shows that there are 3 bands in the 12 red sea breams to be tested, and the sizes are 147bp, 133 bp and 71 bp respectively; 4 bands in the 6 red sea bream and black sea bream hybrids, which are 231 bp in size respectively. bp, 153 bp, 133 bp and 71 bp. It can be judged from the electrophoresis pattern that the 12 sea breams detected are all red sea breams.
Embodiment 3
[0047] There were 7 red breams and 8 black breams to be inspected, and 6 red breams and black breams were used as controls. 30 μL of blood cells were taken from each fish and genomic DNA was extracted. The method as described in Example 1 was used for PCR amplification, detection, and enzyme digestion, and the enzyme digestion product was electrophoresed with 3% agarose to take pictures and record the electrophoresis results. Such as image 3 According to the electrophoresis test shown, there are 4 bands in 6 red sea breams and black sea bream hybrids, which are 231 bp, 153 bp, 133 bp and 71 bp respectively; 7 red sea breams to be tested have 3 bands, The sizes are 147bp, 133 bp and 71 bp respectively; the 8 black breams to be tested have 2 bands, which are 231 bp and 153 bp respectively. It can be determined from the electrophoresis pattern: the 7 red breams and the 8 black breams tested are all For purebred, no germplasm mixed.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



