Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A primer, kit and identification method for identifying red sea bream, black sea bream and their hybrid offspring

A kit, the technology of black sea bream, is applied in the directions of biochemical equipment and methods, microbial determination/inspection, DNA/RNA fragments, etc.

Inactive Publication Date: 2019-11-29
FRESHWATER FISHERIES RES CENT OF CHINESE ACAD OF FISHERY SCI +1
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the shape of the hybrid is very similar to that of the parent, so it is easy to cause the germplasm of sea bream to be mixed in production, resulting in the mixed degeneration of the germplasm

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A primer, kit and identification method for identifying red sea bream, black sea bream and their hybrid offspring
  • A primer, kit and identification method for identifying red sea bream, black sea bream and their hybrid offspring
  • A primer, kit and identification method for identifying red sea bream, black sea bream and their hybrid offspring

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] A total of 24 samples of 8 red sea bream, 8 black sea bream and their hybrid offspring were collected from the Lvsi base of Jiangsu Institute of Oceanography and Fisheries. Take 30 μL of blood cells from each fish to extract genomic DNA, and use the extracted genomic DNA as a template for PCR amplification. The sense primer is: 5′GACGATTATGATGATGGCCACTGAAC 3′ (SEQ ID NO.1), and the antisense primer is: 5′ CTCCCCATCCACCTGGACGAC 3′ (SEQ ID NO.2), the total volume of the PCR system is 20 µL, which contains 1× reaction buffer, Mg 2+ 2 mmol / L, dNTP 200 μmol / L, upstream and downstream primers 0.2 μmol / L, Taq enzyme 0.5 U, DNA template 100 ng-200 ng, make up the volume with sterile double distilled water. The PCR reaction conditions were: 94°C for 2 min; 30 cycles of 94°C for 40 s, 60°C for 40 s, 72°C for 40 min, 30 cycles; 72°C for 5 min, and 4°C for storage. After the PCR reaction was finished, 7 μL of the PCR reaction product was taken from each sample and detected by ele...

Embodiment 2

[0045] 12 red sea breams to be checked, 6 red sea bream hybrids and black sea bream hybrids were used as a comparison, the tail fins of each fish were clipped and genomic DNA was extracted, and PCR amplification, detection, and re-amplification were carried out as described in Example 1. Enzyme digestion, the digested products were electrophoresed with 3% agarose to take pictures and record the electrophoresis results. Such as figure 2 The electrophoresis test shown shows that there are 3 bands in the 12 red sea breams to be tested, and the sizes are 147bp, 133 bp and 71 bp respectively; 4 bands in the 6 red sea bream and black sea bream hybrids, which are 231 bp in size respectively. bp, 153 bp, 133 bp and 71 bp. It can be judged from the electrophoresis pattern that the 12 sea breams detected are all red sea breams.

Embodiment 3

[0047] There were 7 red breams and 8 black breams to be inspected, and 6 red breams and black breams were used as controls. 30 μL of blood cells were taken from each fish and genomic DNA was extracted. The method as described in Example 1 was used for PCR amplification, detection, and enzyme digestion, and the enzyme digestion product was electrophoresed with 3% agarose to take pictures and record the electrophoresis results. Such as image 3 According to the electrophoresis test shown, there are 4 bands in 6 red sea breams and black sea bream hybrids, which are 231 bp, 153 bp, 133 bp and 71 bp respectively; 7 red sea breams to be tested have 3 bands, The sizes are 147bp, 133 bp and 71 bp respectively; the 8 black breams to be tested have 2 bands, which are 231 bp and 153 bp respectively. It can be determined from the electrophoresis pattern: the 7 red breams and the 8 black breams tested are all For purebred, no germplasm mixed.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention discloses primers, kit and identification method for identifying Pagrosomus major, Acanthopagrus schlegeli and their hybrids, wherein the kit includes the primers, a buffer solution, enzymes and the like, and the identification method includes: first, acquiring a snapper sample to be identified, and extracting genome DNA; second, using the genome DAN as a template to carry out PCR (polymerase chain reaction) amplification; third, subjecting an amplified product to enzyme restriction and electrophoresis, and identifying according to characteristic bands. The primers, kit and identification method help quickly and accurately identify Pagrosomus major, Acanthopagrus schlegeli and their hybrids and are of great application value in snapper germplasm identification, breed conservation and selective breeding.

Description

technical field [0001] The invention belongs to the technical field of fish molecular markers, and relates to a primer, a kit and an identification method for identifying red sea bream, black sea bream and their hybrid offspring. Background technique [0002] red sea bream Pagrosomus major Perciformes, Seabreamidae, Red Seabream, Black Sea Bream Spraus macrocephalus It belongs to Perciformes, Bremidae and Black Bream, all of which are important economic fishes for marine aquaculture in my country. Red sea bream has the characteristics of large body, fast growth, good meat quality, beautiful color, and strong disease resistance, but it is sensitive to changes in salinity and temperature and has poor stress resistance; black sea bream has a wide range of adaptability to temperature and salinity, but It grows slowly and takes a long time to grow. Through the hybrid breeding of red sea bream and black sea bream, hybrid offspring with excellent traits of both parents can be o...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6888C12N15/11
CPCC12Q1/686C12Q1/6888C12Q2565/125
Inventor 李建林俞菊华张志勇张志伟李红霞唐永凯于凡徐跑
Owner FRESHWATER FISHERIES RES CENT OF CHINESE ACAD OF FISHERY SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com