Carbonyl reductase mutant as well as gene and application thereof

A reductase and mutant technology, which is applied in the field of biology and can solve the problems of poor reaction stability, low activity for reducing ethyl 4-chloro-3-carbonyl butyrate and the like

Active Publication Date: 2017-05-31
EAST CHINA UNIV OF SCI & TECH
View PDF3 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The technical problem to be solved by the present invention is: carbonyl reductase ScCR1 catalyzes the reduction of 4-chloro-3-carbonyl butyric acid ethyl ester with low activity and poor reaction stability

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Carbonyl reductase mutant as well as gene and application thereof
  • Carbonyl reductase mutant as well as gene and application thereof
  • Carbonyl reductase mutant as well as gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Site-directed mutagenesis of carbonyl reductase ScCR1

[0040] Site-directed mutagenesis using II Site-Directed Mutagenesis Kit (Stratagene, Catalog #200522) program to operate.

[0041] First design degenerate mutation primers containing mutation points as follows:

[0042] 5'-ACGTCGCCTCC NNK CTCGGCTCGGTCGGCT-3',

[0043] 5’-AGCCGACCGAGCCGAG MNN GGAGGCGACGT-3'.

[0044] Among them, N represents a mixture of four bases A, T, C, and G; K represents a mixture of two bases G and T; M represents a mixture of two bases A and C.

[0045] The template used therein is: wild-type carbonyl reductase recombinant plasmid, including the gene sequence shown in SEQ ID No.1.

[0046] The PCR amplification program (50μl) is: template 0.5~20ng, 5μl 10×KOD plus buffer, 5μl dNTP (each 2.0mM), 2μl MgSO 4 (25 mM), 1 μl of each pair of mutant primers (20 μM), 1 unit of KOD enzyme (TOYOBO CO., LTD., Osaka, Japan), and sterilized distilled water to make up to 50 μl.

[0047]PCR amplif...

Embodiment 2

[0050] Random mutation of the carbonyl reductase ScCR1

[0051] Using error-prone PCR technology to introduce random nucleotide mutations into the carbonyl reductase gene, the primers used are as follows:

[0052] Upstream primer: GGAATTCCATATGACTGTCGAAACCGCCACC

[0053] Downstream primer: CGCGGATCCCTAGACAGAACAGTAACCACCT

[0054] Wherein the template is: Embodiment 1 obtains the carbonyl reductase mutant plasmid pET28a-ScCR1 I158V .

[0055] The PCR reaction system (50μl) is: template 0.5~20ng, 5μl 10×rTaq buffer, 5μl dNTP (each 2.0mM), 2μl MgSO 4 (25mM), 5μl MnCl 2 (100 μM), 1 μl of each pair of mutant primers (20 μM), 1 unit of rTaq enzyme (TaKaRa, Japan), 1 μl of DMSO, and sterilized distilled water to make up to 50 μl.

[0056] The program of error-prone PCR amplification is: (1) denaturation at 95°C for 3min; (2) denaturation at 98°C for 10sec, (3) annealing at 55°C for 20sec, (4) extension at 72°C for 90sec, steps (2) to (4 ) for a total of 3 cycles, (5) denaturati...

Embodiment 3

[0059] random mutation

[0060] Using error-prone PCR technology to introduce random nucleotide mutations into the carbonyl reductase gene, the primers used are as follows:

[0061] Upstream primer: GGAATTCCATATGACTGTCGAAACCGCCACC

[0062] Downstream primer: CGCGGATCCCTAGACAGAACAGTAACCACCT

[0063] Wherein the template is: Embodiment 2 obtains the carbonyl reductase mutant plasmid pET28a-ScCR1 I158V / P168S .

[0064] The PCR reaction system (50μl) is: template 0.5~20ng, 5μl 10×rTaq buffer, 5μl dNTP (each 2.0mM), 2μl MgSO 4 (25mM), 5μl MnCl 2 (100 μM), 1 μl of each pair of mutant primers (20 μM), 1 unit of rTaq enzyme (TaKaRa, Japan), 1 μl of DMSO, and sterilized distilled water to make up to 50 μl.

[0065] The program of error-prone PCR amplification is: (1) denaturation at 95°C for 3min; (2) denaturation at 98°C for 10sec, (3) annealing at 55°C for 20sec, (4) extension at 72°C for 90sec, steps (2) to (4 ) for a total of 3 cycles, (5) denaturation at 98°C for 10 sec, (6)...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to view more

Abstract

The invention relates to a carbonyl reductase mutant and a gene thereof, a recombinant expression carrier and a recombinant expression transformant with the gene of the carbonyl reductase mutant, a preparation method of a recombinant enzyme, and application of the recombinant enzyme in asymmetric reduced 4-chlorine-ethyl-3-oxobutanoate and other prochiral carbonyl compounds to prepare optical pure (S)-4-chlorine-3-hydroxy-ethyl butyrate and other chiral secondary alcohol. Compared with wild type carbonyl reductase, the carbonyl reductase mutant provided by the invention is greatly improved in reduction activity on 4-chlorine-ethyl-3-oxobutanoate, the thermal stability of a part of the mutant is also remarkably improved, the optical pure (S)-4-chlorine-3-hydroxy-ethyl butyrate can be relatively well prepared by using the mutant, and very good industrial application prospects can be achieved.

Description

technical field [0001] The invention belongs to the technical field of bioengineering, and specifically relates to a Streptomyces coelicolor carbonyl reductase ScCR1 mutant and its coding gene, a recombinant expression vector and a recombinant expression transformant containing the carbonyl reductase mutant gene, the recombinant carbonyl reduction Enzyme and its preparation method, and the application of the carbonyl reductase mutant in catalyzing the asymmetric reduction of ethyl 4-chloro-3-carbonyl butyrate to prepare optically pure (S)-ethyl 4-chloro-3-hydroxybutyrate . Background technique [0002] (S)-4-Chloro-3-hydroxybutyrate ethyl ester [Ethyl(S)-(-)-4-chloro-3-hydroxybutyrate,(S)-CHBE], molecular formula: C 6 h 11 ClO 3 , molecular weight: 166.60, CAS No. 86728-85-0. Optically pure ethyl (S)-4-chloro-3-hydroxybutyrate [(S)-CHBE] is an important pharmaceutical for the synthesis of 3-hydroxy-3-methylglutaryl coenzyme (HMG-CoA) reductase inhibitors intermediate. ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/04C12N15/53C12P41/00C12P7/62
Inventor 张志钧郁惠蕾李敏许建和潘江
Owner EAST CHINA UNIV OF SCI & TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap