Transient expression vector carrying NtRBSC1 gene

A transient expression and gene technology, applied in genetic engineering, using vectors to introduce foreign genetic material, recombinant DNA technology, etc., can solve the problems of lack of research on positioning and its mechanism of action

Inactive Publication Date: 2017-08-18
ZHENGZHOU TOBACCO RES INST OF CNTC
View PDF1 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

For this enzyme, the prior art still mainly focuses on basic work such as the cloning and analysis of the enzyme-encoding gene, but the specific location of the enzyme in cells and its mechanism of action are still relatively lacking.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Transient expression vector carrying NtRBSC1 gene
  • Transient expression vector carrying NtRBSC1 gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0046] The transient expression vector carrying NtRBSC1 gene provided by this application, which carries NtRBSC1 (Ntab0062040)) and a gene of fluorescent marker protein GFP (using fluorescent marker protein GFP gene as reporter gene), its preparation method is described in detail as follows.

[0047] (1) PCR amplification to obtain the NtRBSC1 gene, specifically:

[0048] The total RNA (RIN ≥ 7.5) was extracted from Honghua Dajinyuan tobacco variety, and cDNA was further reverse-transcribed. Using this as a template, the NtRBSC1-F / NtRBSC1-R primer pair was designed for PCR amplification. The amplified product of the NtRBSC1 gene was obtained and recovered.

[0049]The NtRBSC1-F / NtRBSC1-R primer pair is designed using DNAMAN6.0 in combination with the NtRBSC1 gene sequence. The base sequence of the NtRBSC1 gene is shown in SEQ ID NO: 1; the specific sequence of the designed primers is:

[0050] NtRBSC1-F: CGGGGTACCATGTCTGTCTCAAGTT, wherein the partial sequence of GGTACC is the...

Embodiment 2

[0081] The NtRBSC1-pFF19-GFP plasmid vector prepared in Example 1 was transformed into tobacco protoplasts by the PEG-mediated tobacco protoplast transformation method, and further observed by laser confocal microscopy, the tobacco NtRBCS1 can be positioned more intuitively, so as to identify the relevant genes. The research lays the research foundation and application foundation, and the relevant experiments are briefly introduced as follows.

[0082] (1) To prepare tobacco protoplasts, the specific operations are:

[0083] 1. Weigh 0.2g Cellulase R-10 (Solarbio) and 0.08g Macerozyme R-10 (Solarbio), add to 20mL enzyme stock solution, bathe in 55℃ water for 10min, add 200uL of 1M CaCl after cooling 2 (10mM), 0.02g BSA (0.1%), filtered through 0.45μm micropores to make enzymatic hydrolysis solution, transfer it into a 100mL small beaker for later use;

[0084] 2. Take 4-week-old tobacco leaves (Safflower Dajinyuan, healthy and well-growing hypertrophic leaves), transform abou...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of biology and in particular relates to a recombinant transient expression vector carrying a small subunit gene of tobacco ribulose-1,5-bisphosphate carboxylase. One transient expression vector NtRBSC1-pFF19-GFP (Green Fluorescent Protein) is constructed by utilizing a tobacco NtRBSC1 gene; after tobacco cells are transformed through the vector, fused protein of fluorescence labeled gene GFP and NtRBSC1 can be transformed into tobacco protoplasts, so that NtRBSC1 protein is subjected to sub-cellular localization by detecting the position of the fused protein through a laser confocal microscope; the position of chloroplast is displayed. Overall, the manner is a simple and accurate method for localizing in living cells and accurate reference evidence can be provided for research on the chloroplast of the tobacco cells and related genes; research on the tobacco NtRBSC1 gene and deep development of functions of the tobacco NtRBSC1 gene are convenient to realize.

Description

technical field [0001] The invention belongs to the field of biotechnology, and specifically relates to a recombinant transient expression vector carrying a ribulose-1,5-bisphosphate carboxylase small subunit gene (NtRBSC1) gene. Background technique [0002] Chloroplasts are organelles in plant cells that are surrounded by double membranes, contain chlorophyll, and are capable of photosynthesis. Thylakoids composed of membranous vesicles are suspended in the chloroplast stroma, which contain chloroplast DNA. It is a plastid with three shapes: round, oval or disc. The chlorophyll a and b contained in chloroplasts absorb the least green light, and the green light is reflected, so the leaves are green. Chloroplasts are oblate, about 2.5 microns thick, about 5 microns in diameter, with a double-layer membrane and interstitium containing dissolved enzymes and lamellae. Sheets are stacked by closed hollow disk-shaped thylakoids, which are necessary for the formation of high-ene...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/82
CPCC12N15/8207
Inventor陈千思周会娜刘萍萍王燃陈霞翟妞李锋武明珠金立锋
OwnerZHENGZHOU TOBACCO RES INST OF CNTC