A kind of poplar promoter ppstmm induced by plant hormone and its application
A technology of plant hormones and promoters, applied in the fields of application, plant peptides, plant products, etc., can solve the problems of molecular research lag, research interest and insufficient attention, and achieve the effect of improving stress resistance
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] Example 1 Cloning of the pPsTMM promoter
[0040] Using Populus microphylla DNA as material, refer to the poplar genome sequence information (http: / / www.phytozome.net / ), search for about 2000 bp upstream of the PeTMM gene sequence, use Oligo 7 software to design degenerate primers, and amplify the pPsTMM promoter sequence, The high-fidelity PCR reaction system is shown in Table 1. Among them, the degenerate primers include: forward primer: F1-5'ATTGGAGAGTGTGGCCCTCTTTTAC3', F2-5'TGTTGAGCCTGAGTAGCTGTTGGTT3'; reverse primer: R1-5'CGATCAATCCACCCACCCAGCTTTA3', R2-5'GTTGGTGCGTGGAGTGAAAAGGCTA3'.
[0041] Among them, the DNA of Populus microphylla was extracted using a novel genomic DNA extraction kit (DP320) produced by Tiangen Biochemical Technology (Beijing) Co., Ltd.
[0042] Table 1 High-fidelity PCR reaction system
[0043]
[0044]
[0045] The reaction conditions are as follows: (1) Pre-denaturation at 94°C for 3min; (2) 94°C for 30s-60°C for 30s-72°C for 2min) x ...
Embodiment 2
[0046] Example 2 Construction of pPsTMM-pBI121-GUS vector
[0047] (1) The pPsTMM-pBI121-GUS expression vector was constructed by double enzyme digestion-T4 DNA enzyme linkage technology. Use the Bioxm software to predict the restriction sites of the pPsTMM gene promoter sequence, combined with the 35S-pBI121-GUS expression vector restriction sites, select HindIII (Taraka, 1060S) and BamHI (Taraka, 1010S) respectively to pMD19-pPsTMM vector Perform double enzyme digestion with 35S-pBI121-GUS expression vector, react at 37°C for 12h, and inactivate at 65°C for 10min;
[0048] Among them, the preparation steps of the pMD19-pPsTMM vector (TA clone) are as follows: perform agarose gel electrophoresis on the pPsTMM obtained by PCR amplification in Example 1, and use a recovery kit (thin agarose gel DNA recovery kit, GK2043-50, Shanghai Jierui Biological Engineering Co., Ltd.) purifies and recovers the target product; the recovered target product is combined with the cloning vector...
Embodiment 3
[0060] Example 3 Analysis of expression pattern of pPsTMM promoter
[0061] By electric shock conversion method (Bio-Rad MicroPulser Bole electrotransfer instrument; electric shock cup: Bio-Rad Bole electric shock cup 1652086; electric shock conditions: output range 200-3000v, precision 10v, use voltage 2.5kv, time constant 1.0ms, precision 0.1ms, Use temperature: room temperature; resistance: rifampicin Rif) The constructed pPsTMM-pBI121-GUS is transformed into Agrobacterium strain LBA4404 (Invitrogen), through Agrobacterium-mediated technology (He Guangyuan. Plant Genetic Engineering Experiment Manual [M] .Beijing: Tsinghua University Press, 2007)
[0062] The pPsTMM promoter was transformed into tobacco. The T1 generation tobacco plants transfected with the pPsTMM promoter vector were treated with 1 mM GA, NAA, ABA and SA, and all treatment controls were sprayed with deionized water instead. After 24 hours, the GUS staining results were as follows: figure 2 : A-unstresse...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More