Modulation of androgen receptor expression
An oligonucleotide and compound technology applied in the field of regulation of androgen receptor expression
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
example 1
[0758] Example 1: Antisense inhibition of human AR in HuVEC cells
[0759] Antisense oligonucleotides were designed to target AR nucleic acids and they were tested for their effect on AR mRNA in vitro. These antisense oligonucleotides were tested in a series of experiments with similar culture conditions. The results for each experiment are presented in separate tables shown below. Cultured HuVEC cells at a density of 20,000 cells per well were transfected with 500 nM antisense oligonucleotides using electroporation. After an approximately 24 hour treatment period, RNA was isolated from the cells and AR mRNA levels were measured by quantitative real-time PCR. Human primer probe set RTS3559 (forward sequence TCCTTCACCAATGTCAACTCC, designated herein as SEQ ID NO: 9; reverse sequence GAGCCATCCAAACTCTTGAGA, designated herein as SEQ ID NO: 10; probe sequence AGTACCGCATGCACAAGTCCCG, designated herein as SEQ ID NO: :11) Measure mRNA levels. According to as passed Measured total...
example 2
[0766] Example 2: Dose-dependent antisense inhibition of human AR in HuVEC cells
[0767] Notch bodies from the above studies and exhibiting significant in vitro inhibition of AR mRNA were selected and tested in HuVEC cells at different doses. Cells were plated at a density of 20,000 cells / well and transfected using electroporation with antisense oligonucleotides at concentrations of 18.5 nM, 55.6 nM, 166.7 nM, 500.0 nM and 1500.0 nM, as in Table 3 and Table 4 specified. After a treatment period of approximately 16 hours, RNA was isolated from the cells and AR mRNA levels were measured by real-time quantitative PCR. mRNA levels were measured using the human AR primer probe set RTS3559. According to as passed Measured total RNA content, calibrated to AR mRNA levels. Results are presented as percent inhibition of AR relative to untreated control cells. These antisense oligonucleotides were tested in a series of experiments with similar culture conditions. The results for e...
example 3
[0773] Example 3: Antisense inhibition of human AR in HuVEC cells
[0774] Additional antisense oligonucleotides were designed to target AR nucleic acids and they were tested for their effect on AR mRNA in vitro. Cultured HuVEC cells at a density of 20,000 cells per well were transfected with 500 nM antisense oligonucleotides using electroporation. After an approximately 24 hour treatment period, RNA was isolated from the cells and AR mRNA levels were measured by quantitative real-time PCR. mRNA levels were measured using the human primer probe set RTS3559. According to as passed Measured total RNA content, calibrated to AR mRNA levels. Results are presented as percent inhibition of AR relative to untreated control cells. A total of 82 oligonucleotides were tested. Only those oligonucleotides selected for further studies are shown in Table 5.
[0775] The newly designed chimeric antisense oligonucleotides in Table 5 were designed as 3-10-3(S)-cET gapbody or 5-10-5MOE ga...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap