Modulation of androgen receptor expression

An oligonucleotide and compound technology applied in the field of regulation of androgen receptor expression

Active Publication Date: 2018-07-20
SUZHOU RIBO LIFE SCIENCE CO LTD
View PDF72 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although most patients initially respond to ADT, most will eventually develop castration resistance, in which case the disease progresses regardless of castration levels of testosterone

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Modulation of androgen receptor expression
  • Modulation of androgen receptor expression
  • Modulation of androgen receptor expression

Examples

Experimental program
Comparison scheme
Effect test

example 1

[0758] Example 1: Antisense inhibition of human AR in HuVEC cells

[0759] Antisense oligonucleotides were designed to target AR nucleic acids and they were tested for their effect on AR mRNA in vitro. These antisense oligonucleotides were tested in a series of experiments with similar culture conditions. The results for each experiment are presented in separate tables shown below. Cultured HuVEC cells at a density of 20,000 cells per well were transfected with 500 nM antisense oligonucleotides using electroporation. After an approximately 24 hour treatment period, RNA was isolated from the cells and AR mRNA levels were measured by quantitative real-time PCR. Human primer probe set RTS3559 (forward sequence TCCTTCACCAATGTCAACTCC, designated herein as SEQ ID NO: 9; reverse sequence GAGCCATCCAAACTCTTGAGA, designated herein as SEQ ID NO: 10; probe sequence AGTACCGCATGCACAAGTCCCG, designated herein as SEQ ID NO: :11) Measure mRNA levels. According to as passed Measured total...

example 2

[0766] Example 2: Dose-dependent antisense inhibition of human AR in HuVEC cells

[0767] Notch bodies from the above studies and exhibiting significant in vitro inhibition of AR mRNA were selected and tested in HuVEC cells at different doses. Cells were plated at a density of 20,000 cells / well and transfected using electroporation with antisense oligonucleotides at concentrations of 18.5 nM, 55.6 nM, 166.7 nM, 500.0 nM and 1500.0 nM, as in Table 3 and Table 4 specified. After a treatment period of approximately 16 hours, RNA was isolated from the cells and AR mRNA levels were measured by real-time quantitative PCR. mRNA levels were measured using the human AR primer probe set RTS3559. According to as passed Measured total RNA content, calibrated to AR mRNA levels. Results are presented as percent inhibition of AR relative to untreated control cells. These antisense oligonucleotides were tested in a series of experiments with similar culture conditions. The results for e...

example 3

[0773] Example 3: Antisense inhibition of human AR in HuVEC cells

[0774] Additional antisense oligonucleotides were designed to target AR nucleic acids and they were tested for their effect on AR mRNA in vitro. Cultured HuVEC cells at a density of 20,000 cells per well were transfected with 500 nM antisense oligonucleotides using electroporation. After an approximately 24 hour treatment period, RNA was isolated from the cells and AR mRNA levels were measured by quantitative real-time PCR. mRNA levels were measured using the human primer probe set RTS3559. According to as passed Measured total RNA content, calibrated to AR mRNA levels. Results are presented as percent inhibition of AR relative to untreated control cells. A total of 82 oligonucleotides were tested. Only those oligonucleotides selected for further studies are shown in Table 5.

[0775] The newly designed chimeric antisense oligonucleotides in Table 5 were designed as 3-10-3(S)-cET gapbody or 5-10-5MOE ga...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

Certain embodiments are directed to compounds and compositions targeted to human androgen receptor (AR) for inhibiting androgen receptor levels in a cell, which can be useful for methods of treating cancer and inhibiting cancer cell growth or proliferation. Several embodiments provided herein relate to the discovery of compounds and compositions for inhibiting androgen receptor levels in a cell, which can be useful for methods of treating cancer and inhibiting proliferation or growth of cancer cells, such as prostate, breast, ovarian, gastric or bladder cancer or cancer cells.

Description

[0001] This application is a divisional application with the same invention title as the parent application. The Chinese application number of the parent application is 201380052830.2, the international application number is PCT / US2013 / 064479, and the filing date is October 11, 2013. [0002] sequence listing [0003] This application is filed with a sequence listing in electronic format. The sequence listing is provided as a file titled 200157WOSEQ.txt, created on October 1, 2013, and is approximately 556KB in size. The information in the sequence listing in electronic format is hereby incorporated by reference in its entirety. technical field [0004] Certain embodiments are directed to compounds and compositions targeting human androgen receptor (AR) for inhibiting the level of androgen receptor in cells, these compounds and compositions are useful in methods of treating cancer and inhibiting the growth or proliferation of cancer cells can be useful. Background techniq...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/113
CPCC12N2310/11C12N2310/315C12N2310/321C12N2310/3231C12N2310/3341C12N2310/341C12N15/1138A61K31/7088A61K31/4166A61P13/08A61P15/00A61P35/00A61P43/00C12N2310/346C12N2310/3525C12N2320/30
Inventor R.A.麦克劳德金永秀周天媛S.M.弗赖尔P.P.塞思E.斯韦兹B.P.莫尼亚
Owner SUZHOU RIBO LIFE SCIENCE CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap