Non-resistance screening double antigen anchor expression vector plq2a and its preparation method

An expression vector and non-resistance technology, which is applied in the field of Lactobacillus plantarum non-resistance screening double antigen-anchored expression vector pLQ2a and its preparation field, can solve the problem of positive recombination in screening of exogenous plasmid electrotransformin host bacteria and Lactobacillus plantarum ligation products Difficulties in fertilization, cell wall thickness of Lactobacillus plantarum, etc.

Active Publication Date: 2020-06-30
JILIN AGRICULTURAL UNIV
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The purpose of the present invention is to solve the problem of the cell wall thickness of Lactobacillus plantarum, the difficulty of screening positive recombinants from exogenous plasmid electroconverter host bacteria and the connection product of Lactobacillus plantarum, and provide a E. coli 6212 / Δalr can be replicated in L. plantarum Resistance-free screening of anchor expression vector pLQ2a in NC8 / Δalr

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Non-resistance screening double antigen anchor expression vector plq2a and its preparation method
  • Non-resistance screening double antigen anchor expression vector plq2a and its preparation method
  • Non-resistance screening double antigen anchor expression vector plq2a and its preparation method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] Example 1 Using alr-EM to double-label the alr gene in the vector 409eatf and host bacteria L. plantarum NC8 / Δalr nutritional complementation screening validation

[0044] (1) pSIP409PgsA'-IL-10 double digestion

[0045] Digest with SalI and PstI, and recover the 4436bp gene fragment containing erythromycin and the replicon on the carrier by agarose gel electrophoresis. The base sequence of the fragment is shown in SEQ ID NO.6.

[0046] (2) Alr t and alr tf gene amplification

[0047] extract L. plantarum The genome of NC8 strain was used as a template to design primers. The primer alr gene contains a SalI restriction site, which is not convenient for vector construction. Therefore, the primers were extended during design, so that alr can be amplified and mutated. The first C in the restriction site was mutated to G, and the amplified gene was named alr t (1149bp). In order to detect the expression of the alr gene after returning to Lactobacillus plantarum, a Fla...

Embodiment 2

[0078] Example 2 Construction of nutritionally complementary asd-alr double-labeled plasmid vector 409ata and its use in E. coli 6212 / Δasd and L. plantarum NC8 / Δalr non-resistance screening verification

[0079] (1) Plasmid 409eat was double digested with BamHI and SalI, and a 4625bp fragment containing the replicon and alr gene was recovered. The base sequence is shown in SEQ ID NO.7.

[0080] (2) Amplify the asd gene, use the PYA4545 plasmid as a template, and use the following primers to amplify a 1758bp fragment containing homologous defects.

[0081] Pasd positive F: CGCTATGCGTGCG GGATCCTCTTCCCTAAATTTAAATATAAAC (underlined is the sequence homologous to the vector, italicized BamHI)

[0082] Pasd R: GGGTTGTCAGGGCTTTTC GTC GAC AACATCAGGTAGTGACA (underlined is the sequence homologous to the vector, italicized to mark Sal I)

[0083] a. The PCR reaction system is as follows:

[0084]

[0085] b. PCR reaction conditions are as follows:

[0086]

[0087] (3...

Embodiment 3

[0090] Example 3 No anti-screening anchor co-anchor expression EGFP and Mcherry verification

[0091] (1) Construction and verification of single-anchor expression EGFP plasmid pSIP409PgsA’-EGFPAT without anti-screening

[0092] 1) Based on the plasmid pSIP409PgsA'-EGFP, replace the EM gene on the vector with asd-alr. Refer to the 409ata gene sequence to design seamless cloning primers containing homologous sequences. The designed primers are versatile. The upstream of the primers is designed with reference to the "256rep" replicon on the vector. Using this primer, the seamless cloning method can be used to clone this series of vectors. The erythromycin was replaced with the asd-alr gene to construct an expression vector for non-resistance screening. The amplified fragment was named 256-asd-alr, the fragment size was 3719bp, and the base sequence was shown in SEQ ID NO.8; The homology arm was added during amplification, so the amplified fragment size was 3765bp.

[0093] Amp...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a non-resistant plantarum lactobacillus anchor expression vector pLQ2a, the base sequence of which is shown in SEQ ID NO.1; it is a biosafety exogenous protein expression system, with asd deletion strain E. coli 6212 / Δasd and alr missing L. plantarum NC8 / Δalr is the host bacterium, which will be derived from Lactococcus lactis ( Lactococcus lactis subsp.cremoris strain JM4) The P23 promoter on the genome acts as the promoter of alr gene expression , Using pYA4545, pYA4545‑Mcherry, pLP‑1261 Inv, pSIP409PgsA', pSIP409PgsA'‑IL‑10, pSIP409PgsA'‑EGFP as base vectors to construct nutrient complementation screening markers in Escherichia coli with PgsA' and LP‑1261 as dual anchor models ‑Lactobacillus has no anti-anchoring expression vector pLQ2a, and EGFP and Mcherry are used as reporter genes for screening and anchoring expression verification; it solves the problem of low conversion efficiency of Lactobacillus plantarum and it is difficult to screen positive recombinants, and constructs the expression vector pLQ2 both in E. coli 6212 / Δalr replicate expression, but also in L. plantarum Expressed in NC8 / Δalr.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a double-antigen-anchored expression vector pLQ2a for non-resistance screening of Lactobacillus plantarum and a preparation method thereof. Background technique [0002] Lactobacillus plantarum ( Lactobacillus plantarum , L. plantarum ) as an intestinal host strain can tolerate the environment of low pH value and high salt in the stomach, the optimum growth temperature is 30-37 ℃, and can tolerate low temperature of about 10 ℃, but it appears in the environment above 45 ℃ Growth inhibition, commonly found in fermented foods made from cream, meat, vegetables, etc. and can be isolated from most plants, hence the name. Studies have shown that Lactobacillus plantarum complies with the GRAS (Generally Recognized as Safe) regulations of the US Food and Drug Administration (FDA) and the Qualified Presumption of Safety standards of the European Food Safety Authority (EFSA), an...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/74C12N15/66
CPCC12N15/66C12N15/746
Inventor王春凤刘琼姜延龙
OwnerJILIN AGRICULTURAL UNIV