Unlock instant, AI-driven research and patent intelligence for your innovation.

A kind of lycopene high-yielding strain, its preparation method and application

A technology of lycopene and yield, applied to engineering strains with high yield of lycopene, and its preparation field can solve problems such as structural instability, plasmid instability, and separation instability

Active Publication Date: 2022-03-11
EAST CHINA UNIV OF SCI & TECH
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, this engineering strain has the following deficiencies: 1) the three-plasmid system causes the host to extend the period of time too long; 2) there is instability in the plasmid, including separation instability, structural instability and allele segregation (Tyo, K.E.J., etc., NatureBiotechnology, 2009, 27(8):760-765.); 3) Antibiotics need to be added to the medium to maintain the presence of the plasmid
However, the yield of lycopene is extremely low, only 0.66mg / gDCW. Subsequent relying on the plasmid system to overexpress S1 and GC can achieve high yield of lycopene, and the highest yield of lycopene is 68.5mg / L

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of lycopene high-yielding strain, its preparation method and application
  • A kind of lycopene high-yielding strain, its preparation method and application
  • A kind of lycopene high-yielding strain, its preparation method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0073] Embodiment 1, plasmid construction

[0074] 1. Construction of plasmid pCC1E

[0075] 1. The plasmid pETE was amplified by PCR using primers BI5 / BI3 to obtain a DNA fragment ESCC (about 4,100 bp) containing the expression element ES.

[0076] 2. Using the plasmid pCC1FOS as a template and RP5 / FP3 as a primer, the backbone CC1 was obtained by PCR.

[0077] 3. In vitro recombination of the fragment ESCC and the backbone CC1 to obtain the recombinant plasmid pCC1E (see figure 1 ).

[0078] The primer sequences are as follows:

[0079] BI5: GTTTTCCCAGTCACGACAAGGAGATGGCGCCCAA (SEQ ID NO: 1);

[0080] BI3: CCATGATTACGCCAAGCCGGATATAGTTCCTCCTTT (SEQ ID NO: 2);

[0081] RP5: CTTGGCGTAATCATGGTCAT (SEQ ID NO: 3);

[0082] FP3: GTCGTGACTGGGAAAACC (SEQ ID NO: 4).

[0083] The high-fidelity PCR reaction kit used in the present invention is GXL DNA polymerase (TaKaRa) was purchased from Treasure Bioengineering (Dalian) Co., Ltd. Amplification reaction system: ddH 2 O 33 μL,...

Embodiment 2

[0110] Embodiment 2, the construction of recombinant bacteria

[0111] 1. Construction of bacterial strain DH412

[0112] Using Escherichia coli DH411 as the starting strain, the expression element GC was integrated into the non-essential region 8 (corresponding to Genbank: NC_017625.1, 413909-430258bp), and the strain DH412 was obtained. The plasmids used in the first step of homologous recombination are pCNA and pBDC-23ri; the plasmids used in the second step of recombination are pSNK and pETIG. Use primers 8-0 / 8-1 to carry out PCR identification on the recombinants. The positive clone of the first step recombination is about 2,300bp, and the negative clone has no band; the second step of the positive clone is about 4,900bp, and the negative clone is about 2,300bp.

[0113] The primer sequences are as follows:

[0114] 8-0: GTGGTCAGGTACTGGCTAA (SEQ ID NO: 7);

[0115] 8-1: GAAACGCCGTCTTCTGTG (SEQ ID NO: 8).

[0116] 2. Construction of bacterial strain DH422

[0117] Usi...

Embodiment 3

[0137] Example 3, construction of high-yielding lycopene-integrated engineering strains

[0138] 1. Explore the speed limit steps

[0139] The starting strain is the 411 strain, which contains a single copy of the expression elements mvaE and mvaS (ES), a single copy of the expression elements mvk, mvaK2, mvd1, fni (S1), a single copy of the expression elements idsA, crtB and crtI (GC).

[0140] The single-copy plasmids pCC1E, pCC1S, pCC1G, pCC1ES, pCC1EG and pCC1SG loaded with different metabolic pathways were transformed into strain DH411 respectively, and the following engineering strains were obtained:

[0141] D411E: Transferred into pCC1E, there are double copies of ES, single copy of S1, and single copy of GC.

[0142] D411S: Transferred into pCC1S, there is a single copy of ES, a double copy of S1, and a single copy of GC.

[0143] D411G: Transferred into pCC1G, there is a single copy of ES, a single copy of S1, and a double copy of GC.

[0144] D411ES: Transferred ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a lycopene high-yield bacterial strain, its preparation method and application. The present inventors modified the heterologous metabolic pathway of Escherichia coli by genetic engineering, further integrated the MVA downstream pathway and the lycopene pathway into different sites of the Escherichia coli genome, and obtained a high-yielding lycopene engineering strain.

Description

technical field [0001] The invention belongs to the field of synthetic biology, and more specifically, the invention relates to an engineering strain with high lycopene production, a preparation method and application thereof. Background technique [0002] Lycopene is a natural antioxidant and a C 40 Terpenoids, naturally derived from plants or microorganisms. As an essential nutrient for the human body, it has the functions of improving human immunity, anti-aging, and anti-oxidation, and is a best-selling health care product. Studies have shown that lycopene also has a certain preventive effect on cancer. As a natural red pigment that is harmless to the human body, lycopene is also widely used in food and cosmetic industries. [0003] At present, the industrial production of lycopene mainly adopts the following three methods: direct extraction method, chemical synthesis method and microbial synthesis method. The direct extraction method refers to the extraction of lycop...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/70C12N1/21C12N15/52C12N15/53C12N15/54C12N15/60C12N15/61C12P5/02C12R1/19
CPCC12N9/0006C12N9/001C12N9/1029C12N9/1085C12N9/1205C12N9/1229C12N9/88C12N9/90C12N9/93C12N15/70C12P5/007C12Y101/01088C12Y103/99C12Y203/01009C12Y205/01C12Y207/01036C12Y207/04002C12Y401/01033C12Y503/03C12Y602/01003
Inventor 郭美锦韦炎龙方宏清洪琦庄英萍储炬
Owner EAST CHINA UNIV OF SCI & TECH