Unlock instant, AI-driven research and patent intelligence for your innovation.

CD19-car-t cell interfering with ifn-gama expression and its application

A gene expression and expression vector technology, applied in the fields of genetic engineering and cell biology, can solve the problems of patient death, interference with target gene expression, and short duration of interference

Active Publication Date: 2021-03-30
山东省齐鲁细胞治疗工程技术有限公司
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In early July 2016, Seattle-based Juno Therapeutics reported that in the company's clinical trial JCAR015, three patients (later confirmed to be four) died after receiving CAR-T cell therapy, and the FDA immediately stopped In the clinical trial of JCAR015, Juno later explained that the use of the chemotherapy drug fludarabine caused neurotoxins, but many people speculated that it was due to the strong cytokine storm (CRS) generated by the input T cells that caused the death of the patient
The earliest method of using RNAi technology to study gene function in organisms is to directly inject single-stranded siRNA molecules prepared in vitro into nematodes. Although it was later used in gene function research, this method has relatively short interference timeliness. Increased concentration of siRNA for effective interference is often cytotoxic
The current RNAi technology mostly adopts the method of constructing a specific RNAi expression vector. After the vector is introduced into animal and plant cells, the corresponding shRNA, amiRNA, etc. can be transcribed by the RNA polymerase type II or III promoter, and then interfere with its target gene. expression

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • CD19-car-t cell interfering with ifn-gama expression and its application
  • CD19-car-t cell interfering with ifn-gama expression and its application
  • CD19-car-t cell interfering with ifn-gama expression and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0094] Example 1: Synthesis of IFN-gama shRNA capable of being cloned into a vector

[0095] Check the sequence of IFN-gama shRNA on the official website of Sigma-Aldrich China, and select four of them (gama-1, gama-2, gama-3, gama-4), and their nucleotide sequences are shown below.

[0096] gama-1: CCGG GCAGAGCCAAATTGTCTCCTT CTCGAGAAGGAGACAATTTGGCTCTGCTTTTTG.

[0097] gama-2: CCGG TATAAGTGAAGTGATACTATC CTCGAGGATAGTATCACTTCACTTATATTTTG.

[0098] gama-3: CCGG CATTCAGATGTAGCGGATAAT CTCGAGATTATCCGCTACATCTGAATGTTTTTTG.

[0099] gama-4: CCGG GGTTGTCCTGCCTGCAATATT CTCGAGAATATTGCAGGCAGGACAACCTTTTTG.

[0100] Wherein, the underlined sequence is the sequence of siRNA in each.

[0101] The present invention adopts the traditional method of cloning into the vector, and inserts two DNA oligonucleotides encoding the IFN-gamasiRNA sequence into the vector. The DNA oligonucleotide contains a 21-nucleotide long sense siRNA sequence, connected to its reverse complementary antisense...

Embodiment 2

[0119] Example 2: Construction of IFN-gama shRNA and CD19CAR dual expression vector

[0120] Such as figure 1 As shown, CD8 transmembrane signal peptide, myc tag, anti-CD19Scfv, CD8 transmembrane region, 4-1BB co-stimulatory signal region and CD3ZetaTCR activation region, U6 promoter, IFN-gama shRNA were sequentially cloned into the lentiviral backbone plasmid In pHR, the pHR-antiCD19CAR-U6-IFN-gama shRNA plasmid was obtained (there are four kinds of IFN-gama shRNA involved in the experiment, so there are also four kinds of plasmids obtained, respectively as follows).

[0121] The nucleotide sequence of CD8amyc-anti-CD19Scfv-CD8TM-4-1BB-CD3Zeta-U6-IFN-gama shRNA-1 is shown below (shown as SEQ ID NO: 13).

[0122] SEQ ID NO: 13:

[0123] ATGGCCTTACCAGTGACCGCCTTGCTCCTGCCGCTGGCCTTGCTGCTCCACGCCGCCAGGCCGGAGCAGAAGCTGATCAGCGAGGAGGACCTGACTAGTGACATCCAGATGACACAGACTACATCCTCCCTGTCTGCCTCTCTGGGAGACAGAGTCACCATCAGTTGCAGGGCAAGTCAGGACATTAGTAAATATTTAAATTGGTATCAGCAGAAACCAGATGGAACTGTTAAACTCCTGAT...

Embodiment 3

[0131] Example 3: Preparation of pHR-IFN-gama-GFP screening plasmid

[0132] Such as figure 2 As shown, IFN-gama and GFP were sequentially cloned into the lentiviral backbone plasmid pHR to obtain the pHR-IFN-gama-GFP plasmid. GFP in the pHR-IFN-gama-GFP is a reporter gene, which is used to detect the gene silencing efficiency of IFN-gama.

[0133] The nucleotide sequence of the IFN-gama-GFP fusion protein is as follows:

[0134] ATGAAGTACACCAGCTACATCCTGGCCTTTCAGCTGTGCATCGTGCTGGGCAGCCTGGGCTGCTACTGCCAGGACCCCTACGTGAAGGAGGCCGAGAACCTGAAGAAGTACTTCAACGCCGGCCACAGCGACGTGGCCGACAACGGCACCCTGTTCCTCGGCATCCTGAAGAACTGGAAGGAGGAGAGCGACAGGAAGATCATGCAGTCCCAGATCGTGAGCTTCTACTTCAAGCTGTTCAAGAATTTCAAGGACGACCAGAGCATCCAGAAGAGCGTGGAGACCATCAAGGAGGACATGAACGTGAAGTTTTTCAATAGCAACAAGAAGAAGAGGGACGACTTCGAGAAGCTGACCAACTACAGCGTGACCGACCTGAATGTGCAGAGGAAGGCCATCCACGAACTGATCCAGGTGATGGCCGAGCTGAGCCCTGCCGCCAAGACCGGCAAGAGGAAGAGGAGCCAGATGCTGTTCAGGGGCAGGAGGGCCAGCCAGGGATCCATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTC...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses two shRNAs (short hairpin RNA) interfering with human IFN (interferon)-gama gene expression shown as SEQ ID NO: 1 and SEQ ID NO: 2. The invention further discloses a lentiviralexpression vector. The lentiviral expression vector contains the shRNAs interfering with the human IFN-gama gene expression and a chimeric antigen receptor encoding nucleotide fragment shown as SEQ ID NO: 4. The invention further discloses a CD19-CAR-T cell interfering with the human IFN-gama gene expression. The CD19-CAR-T cell is a T lymphocyte containing the lentiviral expression vector, or aT lymphocyte which is integrated with the shRNAs interfering with the human IFN-gama gene expression and the chimeric antigen receptor encoding nucleotide fragment in a chromosome. The IFN-gama shRNAsare introduced into the CAR-T cell, the shRNAs of IFN-gama are coexpressed while CAR is expressed, and release of the IFN-gama is inhibited from the source by a gene silencing technology, so that influence of CRS (cytokine release syndrome) is reduced and the safety of CAR-T treatment is improved. Important application to preparation of medicines for prevention, treatment and adjuvant treatment of malignant tumors can be expected.

Description

technical field [0001] The invention relates to the preparation and application of chimeric antigen receptor T cells (Chimeric Antigen Receptor T cells, CAR-T) targeting CD19 that interfere with the expression of IFN-gama, and belong to the fields of genetic engineering and cell biology. Background technique [0002] In 1989, the concept of chimeric antigen receptor-modified T cells (CAR-T) was first proposed to establish adoptive cell therapy with tumor-specific recognition capabilities. The design of the first-generation CAR is to simply replace the extracellular region of the TCR (Tcell receptor) with scFv (single-chain antibody variable region fragment) fragments derived from specific monoclonal antibodies, retaining the transmembrane structure and intracellular signal transmission In the CD3ζ region, some research groups also use FcR for the intracellular signal transmission part. However, the results of the first-generation CAR clinical trials were very disappointing....

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/113C12N15/11C12N15/867C12N7/01C12N5/10A61K35/17A61P35/00A61P35/02
CPCA61K35/17A61P35/00A61P35/02C12N5/0636C12N7/00C12N15/113C12N15/86C12N2310/10C12N2510/00C12N2740/15021C12N2740/15043
Inventor 谭毅郭红张慧慧
Owner 山东省齐鲁细胞治疗工程技术有限公司