Method for detecting copy number variation of c-MET gene from human peripheral blood CTC and kit

A technology of gene copy number and human peripheral blood, applied in the field of detection of c-MET gene copy number variation, can solve problems such as low CTC content, and achieve the effects of simple operation, time saving and high throughput

Active Publication Date: 2018-11-27
JIANGSU PROVINCE HOSPITAL THE FIRST AFFILIATED HOSPITAL WITH NANJING MEDICAL UNIV
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the content of CTC in peripheral blood is extremely low, and the enrichment and detection of CTC is currently the biggest challenge for its clinical application

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for detecting copy number variation of c-MET gene from human peripheral blood CTC and kit
  • Method for detecting copy number variation of c-MET gene from human peripheral blood CTC and kit
  • Method for detecting copy number variation of c-MET gene from human peripheral blood CTC and kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Example 1: Enrichment of CTCs from human peripheral blood by subtraction method

[0031] Instruments: balances, centrifuges, pipettes, oscillating mixers.

[0032] Reagents: 10×CRC cleaning solution (Taizhou Scitech), Cytelligen cell separation solution (Taizhou Scitech), immunomagnetic bead binding buffer (from IP kit, Shanghai Changzhe Biology).

[0033] step:

[0034] (1) Collect peripheral blood from the patient: In order to avoid epithelial cell contamination, after discarding the first 2mL of blood, use the provided blood collection tube to collect 6.0mL of blood, and immediately invert the blood collection tube 5-10 times.

[0035] (2) Balance the blood collection tube with a balance, mix it upside down and then centrifuge at room temperature at 2000rpm for 20min. Discard the supernatant to the point 5mm above the brownish-red precipitate, add 10×CRC cleaning solution until the yellow line on the label of the blood collection tube is full, cover the yellow tube...

Embodiment 2

[0041] Example 2: Establishment of c-MET gene copy number variation detection method

[0042] In this example, the detection system of c-MET gene and internal reference gene was optimized and confirmed.

[0043] Primers and probes: purchased from Shanghai Sangong.

[0044] The base sequence of the taqman probe corresponding to the c-MET gene is shown in SEQ ID NO: 1:

[0045] attagcctctgtctcggtgg caggttcc;

[0046] The specific upstream and downstream primers for detecting c-MET gene subtypes from human peripheral blood CTCs, the base sequences of which are shown in SEQ ID NO: 2 and SEQ ID NO: 3:

[0047] Upstream primer: tcattggttc caatcacagc t;

[0048] Downstream primer: gccaccgaga cagaggctaa t.

[0049] The base sequence of the taqman probe corresponding to the internal reference gene is shown in SEQ ID NO: 4:

[0050] agcctcccct cctcatgcct tcttgcct;

[0051] The specific upstream and downstream primers of the subtype of the internal reference gene, the base sequence...

Embodiment 3

[0064] Example 3: Detection of c-MET gene copy number variation in CTC cells

[0065] The composition of the 3D PCR detection c-MET gene copy number variation detection kit.

[0066] The c-MET gene copy number variation detection kit of this example includes 1×3D Digital PCR MasterMixv2, 0.1 μmol / L of upstream and downstream primers, and 0.2 μmol / L of probes. The components of the kit are shown in Table 4.

[0067] Primers and probes: purchased from Shanghai Sangong.

[0068] The base sequence of the taqman probe corresponding to the c-MET gene is shown in SEQ ID NO:1.

[0069] Specific upstream and downstream primers for detecting c-MET gene subtypes from human peripheral blood CTCs, the base sequences of which are shown in SEQ ID NO: 2 and SEQ ID NO: 3.

[0070] The base sequence of the taqman probe corresponding to the internal reference gene is shown in SEQ ID NO:4.

[0071] The base sequences of the specific upstream and downstream primers for the subtype of the inter...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for detecting copy number variation of c-MET gene from human peripheral blood CTC, and a kit for detecting copy number variation of c-MET gene from human peripheral blood CTC by utilizing the same and an application thereof in detection of treatment of tumor patients at different stages. By use of the method and the kit, the benefit for carrying out directive individualized medication on patients is achieved, the detection result can be used for clinical individualized treatment, the effectiveness of treatment can be predicted, convenience is brought for selection of clinical medication, the treatment effect is obviously improved and the patients are benefited to a greatest extent; meanwhile, the problem of difficult obtaining of tissue samples also can beavoided and monitoring can be realized in the treatment period of the patients.

Description

technical field [0001] The invention relates to the field of tumor cell detection, in particular to a method and a kit for detecting c-MET gene copy number variation from human peripheral blood CTCs. Background technique [0002] With the advancement of bioanalysis technology and the development of information technology, as well as the in-depth understanding of gene-based medicine, the concept of precision medicine (Precision Medicine) has been extracted from the concepts of system medicine, translation medicine, and 4P medicine, and has become a highly A comprehensive and meticulous new medical model is expected to improve the level of disease prevention and disease treatment. Liquid biopsy was first proposed by Sorrells in 1974. It is a kind of non-invasive pathological detection method for the circulatory system in the patient's body. It can monitor the CTC, ctDNA fragments or exosomes released into the blood by tumors or metastases; this method can be fast, Non-invasiv...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/6886C12Q1/6869
CPCC12Q1/6869C12Q1/6886C12Q2600/156C12Q2535/122
Inventor高雯徐静王学浩
OwnerJIANGSU PROVINCE HOSPITAL THE FIRST AFFILIATED HOSPITAL WITH NANJING MEDICAL UNIV