Unlock instant, AI-driven research and patent intelligence for your innovation.

The application of hedgehog signaling pathway genes and dsRNA related to limb regeneration in Periplaneta americana

A cockroach and gene technology, applied in the field of genes, can solve the problem of undiscovered mutual cannibalism

Active Publication Date: 2019-08-27
MEIZHOU HUASHENG GUANGMEI BIOTECHNOLOGY CO LTD
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, mutual feeding between nymphs or adults was not found, so they can still gather together

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • The application of hedgehog signaling pathway genes and dsRNA related to limb regeneration in Periplaneta americana
  • The application of hedgehog signaling pathway genes and dsRNA related to limb regeneration in Periplaneta americana

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0130] Example 1 Database Search for Hedgehog Signaling Pathway Genes Related to Severe Limb Regeneration

[0131] Based on the Periplaneta americana genome database, the Hh, Ptc, Smo and Ci genes in the Hedgehog signaling pathway of the American cockroach were searched by bioinformatics methods, and after sequence analysis and comparison, the Hh in the Hedgehog signaling pathway of the American cockroach was obtained , Ptc, Smo and Ci gene sequences are respectively SEQ ID No.1, SEQ ID No.2, SEQ ID No.3 and SEQ ID No.4.

[0132] The nucleotide sequence of the Hh gene is shown in SEQ ID No.1:

[0133]ATGAGGGCGGGGGCGCTGATGTGGGGGGCGCTGCTGCTGCTGGCGGCGTCGGCGTCGGGCTGCGGGCCCGGACGAGGGGGAGGGCGCCGTCCCGTGCCCCGCAAGTTGACCCCCCTCGTGTTCAAACAGCACGTGCCCAACGTAAGCGAAAACACCCTTCCAGCAAGCGGTCTCACCGAGGGGCGCGTGACCCGCAAAGACCCTCGCTTCAGGGATCTGGTGCCCAACTACAACGCAGACATCGTGTTCAAGGACGAGGAAGGCACGGGCGCCGACCGCCTCATGACGCAGAGGTGCAAGGAGAAGCTGAACACGCTGGCCATCTCGGTGATGAACCAGTGGCCCGGCGTGAAGCTGCGGGTGACGGAGGGCTGGGACGAGGA...

Embodiment 2d

[0153] The synthesis of embodiment 2dsRNA

[0154] The preparation method of the dsRNA targeting the silenced Hh gene: using pTOPO-Hh as a template, carrying out PCR amplification with primers SEQ ID NO.5 and SEQ ID NO.6 containing T7 promoters at both ends, and then passing the PCR amplification product through T7 RiboMAX TMExpress RNAi System transcription kit (Promega) synthesized dsRNA, the sequence is shown in SEQ ID NO.17;

[0155] Preparation method of dsRNA targeting silencing Ptc gene: using pTOPO-Ptc as a template, using primers SEQ ID NO.7 and SEQ ID NO.8 containing T7 promoters at both ends for PCR amplification, and then using the PCR product as a template T7 RiboMAX TM Express RNAi System transcription kit (Promega) carries out the synthesis of dsRNA, and the nucleotide sequence of dsRNA is SEQID NO.18;

[0156] Preparation method of dsRNA targeting silencing Smo gene: use pTOPO-Smo as a template, use primers SEQ ID NO.9 and SEQ ID NO.10 containing T7 promoter...

Embodiment 3

[0174] Embodiment 3dsRNA in vivo injection affects the regeneration of severed limbs of Periplaneta americana

[0175] In order to verify the function of the screened Hh, Ptc, Smo and Ci genes in the Hedgehog signaling pathway in the process of limb regeneration in Periplaneta americana, dsRNA injection was performed on newly amputated Periplaneta americana. CK that does not target any gene of Periplaneta americana was used as a negative control for dsRNA injection treatment.

[0176] The steps are as follows: first select the larvae of Periplaneta americana (d0) that have just molted, continue to cultivate for one day to make them adapt to the surrounding environment, then inject dsRNA for the first time (d1) to them, and perform injection on one side of the hind limb of Periplaneta americana 24 hours later. Amputation operation (d2) is to keep the complete base and trochanter, and cut off the femur, tibia and tarsus together (see figure 1 A), and then two other dsRNA interf...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a hedgehog signal pathway gene associated with amputated limb regeneration of Periplaneta americana and application of dsRNA thereof. The results showed that Hh gene, Ptc gene,Smo gene and / or Ci gene had the ability to affect the limb regeneration of Periplaneta americana. Moreover, silencing the expression of Hh, Ptc, Smo and Ci genes could inhibit the regeneration ability of Periplaneta americana, which could not only remove the pests of Periplaneta americana efficiently, but also avoid the environmental pollution and is safe and reliable. Hh, Ptc, Smo and Ci gene ofthat invention can be used as control target of Periplaneta americana pest control.

Description

technical field [0001] The invention belongs to the field of genes, and relates to a gene related to limb regeneration of the American cockroach and the application of dsRNA thereof. Background technique [0002] Cockroaches are native to Africa and enjoy a humid, warm, and dark environment; they like to hide in hidden crevices; their activities are concentrated at night, and they are worldwide sanitary pests. Periplaneta americana is the largest insect in the family Blatella. It has a wide range of food habits, likes sugar and starch, pollutes food, spreads germs and parasites, and is a worldwide health pest. In the southern region, it is an indoor dominant species. It mainly lives in dark and humid environments such as sewers, heating ditches, toilets, bathrooms, breweries, and sauce factories, where it is easy to spread diseases. [0003] Periplaneta americana has the ability to avoid light and gather. When raising Periplaneta americana, some folded cardboards and paper ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6888A01N57/16A01P7/04
Inventor 李胜任充华
Owner MEIZHOU HUASHENG GUANGMEI BIOTECHNOLOGY CO LTD