Supercharge Your Innovation With Domain-Expert AI Agents!

Kit for detecting abundance of common probiotics

A technology of probiotics and kits, which is applied in the field of kits for detecting the abundance of common probiotics, can solve problems such as complex composition of intestinal flora, low amplification efficiency, lack of primers, etc., to shorten the detection cycle and reduce detection costs , the effect of high amplification efficiency

Active Publication Date: 2019-01-25
GENETALKS BIO TECH CHANGSHA CO LTD
View PDF3 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The composition of the intestinal flora is complex, and many strains are extremely close to each other. Directly using fluorescent PCR to amplify the intestinal flora often has poor specificity and low amplification efficiency. There are no primers that can cope with such complex samples in the prior art

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit for detecting abundance of common probiotics
  • Kit for detecting abundance of common probiotics
  • Kit for detecting abundance of common probiotics

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0059] Primer sequence:

[0060] Faecalibacterium:

[0061] Upstream sequence: GGTCTTCGGATTGTAAACTCCTG

[0062] Downstream sequence: GTAATTCCGGACAACGCTTGTG

[0063] lactobacillus:

[0064] Upstream sequence: GTGGAACTCCATGTGTAGCGG

[0065] Downstream sequence: GGCGGAAACCCTCCAACAC

[0066] Bifidobacterium:

[0067] Upstream sequence: CGGGTGAGTAATGCGTGACC

[0068] Downstream sequence: TGATAGGACGCGACCCCA

[0069] Akkermansia muciniphila:

[0070] Upstream sequence: CGGCACATGATACTGCGAGAC

[0071] Downstream sequence: TCAGTTAATGTCCAGGAACCCG

[0072] Total bacteria:

[0073] Upstream sequence: CCTACGGGAGGCAGCAG

[0074] Downstream sequence: ATTACCGCGGCTGCTGG.

[0075] The composition of the qPCR reaction system is:

[0076] Element

Volume (μL)

Fluorescent dyes

5

Forward primer (2.5 μM)

0.5

Reverse primer (2.5 μM)

0.5

Template DNA (2ng / μL)

1

UDG enzyme

0.01

water

Make up to 10 μL

[0077] The flu...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a kit for detecting the abundance of common probiotics, as a result of their own technology, analyzing and designing from a large amount of data, the primers with the best specificity and amplification efficiency were screened out, including Faecalibacterium, lactobacillus, Bifidobacterium, akkermansia muciniphil and total bacterial prim that primers of the invention have good amplification specificity and high amplification efficiency, and can specifically amplify the correspond probiotics from the total DNA of the complex intestinal microbial flora, and the result isthe same as that of the mature method. The reagent kit of the invention can realize the rapid and intuitive detection of common probiotics, shortens the detection period and reduces the detection cost.

Description

technical field [0001] The invention relates to a kit for detecting the abundance of common probiotics. Background technique [0002] The intestinal flora includes approximately 2,000 species of bacteria. The composition of intestinal flora is closely related to living habits, diet and host genes, and there are large differences among individuals. Firmicutes, Bacteroidetes, and Actinomycetes, these three phyla dominate the human intestinal flora, anaerobic bacteria such as Bacteroides, Eubacterium, Bifidobacterium, Clostridium, Peptostreptococcus, etc. accounted for the main part of the intestinal flora, while facultative anaerobic bacteria such as Lactobacillus, Enterococcus, Streptococcus, Enterobacter, etc. only accounted for a small part. [0003] The intestinal flora and the host form a dynamic and balanced micro-ecosystem, and participate in various physiological activities: participate in the digestion and absorption of nutrients, ferment cellulose, oligosaccharides...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/689C12Q1/6851C12Q1/06C12R1/225C12R1/01
CPCC12Q1/6851C12Q1/689C12Q2531/113C12Q2563/107
Inventor 宋卓王永利卢秦
Owner GENETALKS BIO TECH CHANGSHA CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More