y2sk2 dehydrin that reduces cell stress damage and improves cryopreservation effect
An ultra-low temperature technology for dehydrin and vitrification, which is applied in the field of Y2SK2 dehydrin and can solve the problems of no development and application
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0051] Embodiment 1, dehydrin protein ApY 2 SK 2 Prokaryotic expression and enrichment purification
[0052] 1. Obtain the coded dehydrin protein ApY 2 SK 2 ORF sequence.
[0053] Using Agapanthus cDNA as a template, ApY with a full length of 561bp was obtained by RACE (rapid-amplification of cDNA ends) gene full-length cloning method 2 SK 2 Gene ORF region sequence (SEQ ID NO.1), encoding ApY 2 SK 2 protein.
[0054] 2. Construction of prokaryotic expression vector
[0055] 1) According to ApY 2 SK 2 For the ORF sequence of the gene and the multiple cloning site in the plasmid, EcoRI and XholⅠ restriction sites were selected, and the primer pET-YSK-S / A was designed by Primer 5.0 software, and the target fragment was amplified by PCR and the restriction site was introduced.
[0056] pET-YSK-S (SEQ ID NO.2): TCGAATTCATGGACATGAGGGATCAGT
[0057] pET-YSK-A (SEQ ID NO.3):AAACTCGAGCTGATGGGAGCCAGG
[0058] 2) For the pET21a plasmid and the ApY after introducing the res...
Embodiment 2
[0062] Embodiment 2, add protein ApY 2 SK 2 , optimize the vitrification cryopreservation system
[0063] 1) Seedling cultivation of Arabidopsis thaliana: Seeds of wild-type Arabidopsis (Col-0) were sterilized and sown on MS solid medium, and seedlings were cultivated for 60 hours. Specifically: Arabidopsis thaliana (Col-0) seeds were sterilized with 70% ethanol and 2% sodium hypochlorite, sown on MS solid medium, and after purification at 4°C for 48 hours, they were transferred to a light incubator with a photoperiod of 8 hours and light exposure. The intensity is 150 μmol m- 2 ·s- 1 , day and night temperature are 25 ℃ and 20 ℃, humidity 60% to 80%. Seedlings germinated for 60 h were taken as samples for cryopreservation by vitrification method.
[0064] 2) Loading liquid treatment: 60h seedlings of Arabidopsis were transferred to the loading liquid and soaked at room temperature for 20 min;
[0065] 3) Vitrification solution treatment: the seedlings were transferre...
Embodiment 3
[0074] Example 3, verification of dehydrin protein ApY 2 SK 2 Protects against oxidative stress
[0075] 1) Add 0.2mL 0.2mM FeSO 4 Mix with 0.2mL 1mM bromopyrogallol, then add 0.2mL 0.5% H 2 o 2 solution and BSA, ApY 2 SK 2 protein solution.
[0076] 2) Add 0.2mL 0.5% H to the experimental group 2 o 2 and BSA solution, ApY 2 SK 2 Protein solution, the concentration is 0.02, 0.05 and 0.1mg / mL; negative control group is added 0.2mL 0.5% H 2 o 2 , no protein solution was added; the blank group did not add H 2 o 2 and protein solution.
[0077] 3) Measure the absorbance value of the sample at a wavelength of 550 nm. The absorbance value of the experimental group was As, and the absorbance value of the negative control group was A C , the absorbance value of the blank group is A 0 .
[0078] 4) Calculate the BSA and ApY of the experimental group 2 SK 2 Relative inhibition rate of protein solution to hydroxyl radical (OH·) generation.
[0079]
[0080] The...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


