Check patentability & draft patents in minutes with Patsnap Eureka AI!

y2sk2 dehydrin that reduces cell stress damage and improves cryopreservation effect

An ultra-low temperature technology for dehydrin and vitrification, which is applied in the field of Y2SK2 dehydrin and can solve the problems of no development and application

Active Publication Date: 2021-05-25
SHANGHAI JIAOTONG UNIV
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The special protective function of dehydrin protein has important application potential, but it has not been developed and applied in related technical fields at present

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • y2sk2 dehydrin that reduces cell stress damage and improves cryopreservation effect
  • y2sk2 dehydrin that reduces cell stress damage and improves cryopreservation effect
  • y2sk2 dehydrin that reduces cell stress damage and improves cryopreservation effect

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0051] Embodiment 1, dehydrin protein ApY 2 SK 2 Prokaryotic expression and enrichment purification

[0052] 1. Obtain the coded dehydrin protein ApY 2 SK 2 ORF sequence.

[0053] Using Agapanthus cDNA as a template, ApY with a full length of 561bp was obtained by RACE (rapid-amplification of cDNA ends) gene full-length cloning method 2 SK 2 Gene ORF region sequence (SEQ ID NO.1), encoding ApY 2 SK 2 protein.

[0054] 2. Construction of prokaryotic expression vector

[0055] 1) According to ApY 2 SK 2 For the ORF sequence of the gene and the multiple cloning site in the plasmid, EcoRI and XholⅠ restriction sites were selected, and the primer pET-YSK-S / A was designed by Primer 5.0 software, and the target fragment was amplified by PCR and the restriction site was introduced.

[0056] pET-YSK-S (SEQ ID NO.2): TCGAATTCATGGACATGAGGGATCAGT

[0057] pET-YSK-A (SEQ ID NO.3):AAACTCGAGCTGATGGGAGCCAGG

[0058] 2) For the pET21a plasmid and the ApY after introducing the res...

Embodiment 2

[0062] Embodiment 2, add protein ApY 2 SK 2 , optimize the vitrification cryopreservation system

[0063] 1) Seedling cultivation of Arabidopsis thaliana: Seeds of wild-type Arabidopsis (Col-0) were sterilized and sown on MS solid medium, and seedlings were cultivated for 60 hours. Specifically: Arabidopsis thaliana (Col-0) seeds were sterilized with 70% ethanol and 2% sodium hypochlorite, sown on MS solid medium, and after purification at 4°C for 48 hours, they were transferred to a light incubator with a photoperiod of 8 hours and light exposure. The intensity is 150 μmol m- 2 ·s- 1 , day and night temperature are 25 ℃ and 20 ℃, humidity 60% to 80%. Seedlings germinated for 60 h were taken as samples for cryopreservation by vitrification method.

[0064] 2) Loading liquid treatment: 60h seedlings of Arabidopsis were transferred to the loading liquid and soaked at room temperature for 20 min;

[0065] 3) Vitrification solution treatment: the seedlings were transferre...

Embodiment 3

[0074] Example 3, verification of dehydrin protein ApY 2 SK 2 Protects against oxidative stress

[0075] 1) Add 0.2mL 0.2mM FeSO 4 Mix with 0.2mL 1mM bromopyrogallol, then add 0.2mL 0.5% H 2 o 2 solution and BSA, ApY 2 SK 2 protein solution.

[0076] 2) Add 0.2mL 0.5% H to the experimental group 2 o 2 and BSA solution, ApY 2 SK 2 Protein solution, the concentration is 0.02, 0.05 and 0.1mg / mL; negative control group is added 0.2mL 0.5% H 2 o 2 , no protein solution was added; the blank group did not add H 2 o 2 and protein solution.

[0077] 3) Measure the absorbance value of the sample at a wavelength of 550 nm. The absorbance value of the experimental group was As, and the absorbance value of the negative control group was A C , the absorbance value of the blank group is A 0 .

[0078] 4) Calculate the BSA and ApY of the experimental group 2 SK 2 Relative inhibition rate of protein solution to hydroxyl radical (OH·) generation.

[0079]

[0080] The...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a Y which reduces cell stress damage and improves the cryopreservation effect. 2 SK 2 Dehydrin: This protein has the ability to scavenge active oxygen and reduce cell stress damage, which can effectively improve the growth rate of cells after freezing, and significantly improve the efficiency of cryopreservation. The specific method is to apply the method of prokaryotic expression to enrich and purify Agapanthus Y 2 SK 2 type dehydrin (ApY 2 SK 2 ), using the Fenton reaction to prove that ApY 2 SK 2 The regulatory effect on ROS metabolism, using the plant cryopreservation evaluation model to verify ApY 2 SK 2 Improved effect on cryopreservation of plant cells. Specifically include: adding 2 μmol / L ApY to the ultra-low temperature vitrification solution 2 SK 2 Protein, the survival rate of plants after freezing has been increased by more than 1 times. The method disclosed in the present invention is significant for removing active oxygen, reducing cell stress damage, improving cell activity after cryopreservation and optimizing preservation efficiency.

Description

technical field [0001] The invention relates to the field of preservation of plant materials, in particular to a kind of Y which can reduce the stress damage of plant cells and optimize the ultra-low temperature preservation effect of plant vitrification. 2 SK 2 type dehydrin. Background technique [0002] Cryopreservation is a biotechnology that preserves biological materials at low temperatures below -80°C. The cell division, growth and metabolic activities of the preserved materials are almost completely stopped, and they are in a relatively stable biological state. They can be preserved for a long time, and their genetic stability can be preserved to the greatest extent. It is currently the only medium- and long-term medium- and long-term plant that does not require continuous subculture. Techniques for conservation of germplasm resources. Vitrification cryopreservation is to place cells or tissues in a vitrification solution composed of a certain proportion of permea...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): A01N3/00
CPCA01N3/00
Inventor 张荻吕可吕珊杨舟
Owner SHANGHAI JIAOTONG UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More