Unlock instant, AI-driven research and patent intelligence for your innovation.

Y2SK2 dehydrin reducing cell stress damage and improving ultralow temperature storage effect

A technology of cryopreservation and dehydrin protein, applied in the field of preservation of plant materials, can solve problems such as no development and application, achieve large application and promotion value, improve recovery growth rate, and optimize cryopreservation effect

Active Publication Date: 2019-03-12
SHANGHAI JIAO TONG UNIV
View PDF5 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The special protective function of dehydrin protein has important application potential, but it has not been developed and applied in related technical fields at present

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Y2SK2 dehydrin reducing cell stress damage and improving ultralow temperature storage effect
  • Y2SK2 dehydrin reducing cell stress damage and improving ultralow temperature storage effect
  • Y2SK2 dehydrin reducing cell stress damage and improving ultralow temperature storage effect

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0051] Embodiment 1, dehydrin protein ApY 2 SK 2 Prokaryotic expression and enrichment purification

[0052] 1. Obtain the coded dehydrin protein ApY 2 SK 2 ORF sequence.

[0053] Using Agapanthus cDNA as a template, ApY with a full length of 561bp was obtained by RACE (rapid-amplification of cDNA ends) gene full-length cloning method 2 SK 2 Gene ORF region sequence (SEQ ID NO.1), encoding ApY 2 SK 2 protein.

[0054] 2. Construction of prokaryotic expression vector

[0055] 1) According to ApY 2 SK 2 For the ORF sequence of the gene and the multiple cloning site in the plasmid, EcoRI and XholⅠ restriction sites were selected, and the primer pET-YSK-S / A was designed using Primer 5.0 software, and the target fragment was amplified by PCR and the restriction site was introduced.

[0056] pET-YSK-S (SEQ ID NO.2): TCGAATTCATGGACATGAGGGATCAGT

[0057] pET-YSK-A (SEQ ID NO.3):AAACTCGAGCTGATGGGAGCCAGG

[0058] 2) For the pET21a plasmid and the ApY after introducing the ...

Embodiment 2

[0062] Embodiment 2, add protein ApY 2 SK 2 , optimize the vitrification cryopreservation system

[0063] 1) Seedling cultivation of Arabidopsis thaliana: Seeds of wild-type Arabidopsis (Col-0) were sterilized and sown on MS solid medium, and seedlings were cultivated for 60 h. Specifically: Arabidopsis thaliana (Col-0) seeds were sterilized with 70% ethanol and 2% sodium hypochlorite, sown on MS solid medium, and after being purified at 4°C for 48 hours, they were transferred to a light incubator with a photoperiod of 8 hours and light exposure. The intensity is 150 μmol m- 2 ·s- 1 , day and night temperature are 25 ℃ and 20 ℃, humidity 60% to 80%. Seedlings germinated for 60 hours were taken as samples for cryopreservation by vitrification method.

[0064] 2) Loading liquid treatment: 60h seedlings of Arabidopsis were transferred to the loading liquid and soaked at room temperature for 20 min;

[0065] 3) Vitrification solution treatment: the seedlings were transfer...

Embodiment 3

[0074] Example 3, verification of dehydrin protein ApY 2 SK 2 Protects against oxidative stress

[0075] 1) Add 0.2mL 0.2mM FeSO 4 Mix with 0.2mL 1mM bromopyrogallol, then add 0.2mL 0.5% H 2 o 2 solution and BSA, ApY 2 SK 2 protein solution.

[0076] 2) Add 0.2mL 0.5% H to the experimental group 2 o 2 and BSA solution, ApY 2 SK 2 Protein solution, the concentration is 0.02, 0.05 and 0.1mg / mL; negative control group added 0.2mL 0.5% H 2 o 2 , no protein solution was added; the blank group did not add H 2 o 2 and protein solution.

[0077] 3) Measure the absorbance value of the sample at a wavelength of 550 nm. The absorbance value of the experimental group was As, and the absorbance value of the negative control group was A C , the absorbance value of the blank group is A 0 .

[0078] 4) Calculate the BSA and ApY of the experimental group 2 SK 2 Relative inhibition rate of protein solution to hydroxyl radical (OH·) generation.

[0079]

[0080] The re...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses Y2SK2 dehydrin reducing cell stress damage and improving the ultralow temperature storage effect. The protein has the capability of removing active oxygen so as to reduce the cell stress damage, can effectively improve the frozen-thawed growth rate of the cell, and obviously increases the ultralow temperature storage efficiency. The method specifically comprises the steps that African agapanthus Y2SK2 type dehydrin (ApY2SK2) is enriched and purified by adopting a prokaryotic expression method, the regulation effect of ApY2SK2 to ROS metabolism is proved by adopting Fenton reaction, and a plant ultralow temperature storage evaluation model is adopted to testify the improvement effect of ApY2SK2 to plant cell ultralow temperature storage. The method specifically comprises the steps that 2 muicron mol / L ApY2SK2 protein is added into an ultralow temperature vitrification solution, and the plant frozen-thawed growth rate is increased 1 time or above. The disclosed method has outstanding optimization on removing active oxygen, reducing cell stress damage, and increasing cell ultralow temperature frozen-thawed activity and storage efficiency.

Description

technical field [0001] The invention relates to the field of preservation of plant materials, in particular to a kind of Y which can reduce the stress damage of plant cells and optimize the ultra-low temperature preservation effect of plant vitrification. 2 SK 2 type dehydrin. Background technique [0002] Cryopreservation is a biotechnology that preserves biological materials at low temperatures below -80°C. The cell division, growth and metabolic activities of the preserved materials are almost completely stopped, and they are in a relatively stable biological state. They can be preserved for a long time, and their genetic stability can be preserved to the greatest extent. It is currently the only medium- and long-term medium- and long-term plant that does not require continuous subculture. Techniques for conservation of germplasm resources. Vitrification cryopreservation is to place cells or tissues in a vitrification solution composed of a certain proportion of permea...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A01N3/00
CPCA01N3/00
Inventor 张荻吕可吕珊杨舟
Owner SHANGHAI JIAO TONG UNIV