Genetic engineered T cell and application

A genetic engineering and cell technology, applied in the field of T lymphocytes, specifically inducing the expression of cytokines, can solve problems such as toxic and side effects

Inactive Publication Date: 2019-03-15
CRAGE MEDICAL CO LTD
View PDF10 Cites 19 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, it has been reported in the literature that when TIL is used to carry the IL12 gene under the control of the NFAT6 promoter for clinical treatment research, although it is found that this treatment method does have good anti-tumor activity, it is also found to have strong toxic side effects (Zhang et al. L1, MorganRA1, Tumor-infiltrating lymphocytes genetically engineered with aninduciblegene encoding interleukin-12 for the immunotherapy of metastatic melanoma. Clin Cancer Res. 2015 May 15; 21(10):2278-88)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Genetic engineered T cell and application
  • Genetic engineered T cell and application
  • Genetic engineered T cell and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1I

[0212] Example 1. Preparation of IL12-GPC3-CAR T cells

[0213] 1. Plasmid construction

[0214] The scFv used in this example is an antibody targeting GPC3, and its nucleic acid sequence is shown in SEQ ID NO: 1. The chimeric antigen receptor used is a second-generation chimeric antigen receptor, which has a CD28 transmembrane domain, a CD28 intracellular domain, and CD3ζ. refer to figure 1 As shown in the plasmid map, the plasmid for IL12-GPC3-CAR T cells was constructed.

[0215] Using pRRLSIN.cPPT.EF-1α as the vector, a lentiviral plasmid pRRLSIN.cPPT.EF-1α-GPC3-CAR-T expressing the second-generation chimeric antigen receptor was constructed. The GPC3-CAR-T sequence consists of CD8α signal peptide (SEQ ID NO: 2), scFv targeting GPC3 (SEQ ID NO: 1), CD8hinge (SEQ ID NO: 3), CD28 transmembrane region (SEQ ID NO: 6 ) and the intracellular signaling domain (SEQ ID NO: 4) and the intracellular segment of CD3 CD3ζ (SEQ ID NO: 5).

[0216] IL12-GPC3-CAR T cells were inserted...

Embodiment 2

[0240] Example 2. Construction of TCR-deficient IL12-GPC3-CAR T cells

[0241] 1. Construction of CRISPR and in vitro transcription of corresponding gRNA

[0242] The two gRNAs used to knock out the TCRα chain are targeting the first exon of the constant region of the TCRα chain. The two gRNA target sequences are:

[0243] TRAC-gRNA-1 (SEQ ID NO: 13):GAGTCTCTCAGCTGGTACA

[0244] TRAC-gRNA-2 (SEQ ID NO: 14): TGTGCTAGACATGAGGTCTA.

[0245] The gRNA in vitro transcription box driven by the T7 promoter is as follows: T7Promoter+target gRNA+guide RNAScaffold

[0246] TRAC-gRNA-1-IVT-Template (SEQ ID NO: 15):

[0247] TAATACGACTCACTATAGAGAGTCTCTCAGCTGGTACAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT

[0248] TRAC-gRNA-2-IVT-Template (SEQ ID NO: 16):

[0249] TAATACGACTCACTATAGTGTGCTAGACATGAGGTCTAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT

[0250] After the DNA sequence of the above TRAC-gRNA-1 / 2-I...

Embodiment 3

[0262] Example 3. Cytotoxicity assay of IL12-GPC3-CAR T cells before and after TCR inactivation

[0263] The CytoTox 96 non-radioactive cytotoxicity detection kit (Promega Company) was used to detect the cytotoxicity. For details, refer to the instructions of the CytoTox 96 non-radioactive cytotoxicity detection kit.

[0264] 1) Target cells: Inoculate 50 μL 2×10 5 / mL of Huh-7, PLC / PRF / 5, SK-HEP-1 cells in 96well plate, wherein, Huh-7 cells, PLC / PRF / 5 cells are GPC3 positive, SK-HEP-1 cells are GPC3 negative;

[0265] 2) Effector cells: IL12-GPC3-CAR T cells added with TCR+ or TCR- according to the effect-to-target ratio of 1:1;

[0266] 3) There are 5 replicate wells in each group, and the average value of the 5 replicate wells is taken. The detection time is the 18th hour. Wherein each experimental group and each control group are as follows:

[0267] Each experimental group: each target cell + the above-mentioned effector cells; control group 1: target cells release LD...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to a T lymphocyte which can specifically induce expression of an exogenous gene, for example a cell factor and can express an exogenous acceptor capable of being combined with atarget antigen and initiating CD3 signal activation. The invention also provides a pharmaceutical composition containing the T lymphocyte and a method for treating diseases such as tumors by using theT lymphocyte or the pharmaceutical composition. The T lymphocyte not only has an excellent killing effect to tumor cells, but also is reduced in side effect obviously, so that the safety of the T lymphocyte is improved greatly.

Description

technical field [0001] The invention belongs to the field of biomedicine, and in particular relates to a T lymphocyte specifically induced to express cytokines, such as IL-12. Background technique [0002] Tumor immunotherapy has received extensive attention and application in recent years, especially the emergence of CAR-T technology, which has made a milestone in the development of human tumor control. [0003] Some anti-tumor active substances such as IL12 have good anti-tumor activity, but at the same time have a strong toxic effect, and may even be lethal (Cohen, J(1995). IL-12 deaths: explanation and a puzzle. Science270:908) . Therefore, using T lymphocytes to selectively and highly express anti-tumor active substances such as IL12 in tumors through inducible promoters is undoubtedly a way to improve efficacy and reduce side effects. For example, if the NFAT6 promoter is used to regulate the expression of IL12 in T cells, then only when T cells are activated, NFAT6 ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N5/10C12N15/85A61K35/17A61P35/00A61P31/00A61P37/04
CPCA61K35/17A61P31/00A61P35/00A61P37/04C07K14/7051C07K2319/02C07K2319/03C12N5/0636C12N2510/00A61K39/0011A61K48/005A61K2039/5156A61K2039/5158C07K14/47C12N15/102C12N15/1138C12N15/907C12N2740/16043C12N5/10C12N2310/20C07K14/70521C07K14/70575C07K16/2818C12N9/22C12N15/86
Inventor 李宗海郭星亮
Owner CRAGE MEDICAL CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap