Unlock instant, AI-driven research and patent intelligence for your innovation.

Composition for preventing drying of gel, gel composite and DNA chip containing said composite, and method for producing said composition, composite, and chip

A DNA chip and anti-drying technology, applied in the direction of DNA preparation, recombinant DNA technology, biochemical equipment and methods, etc., can solve the problems of hindering nucleic acid probe hybridization reaction, gel degradation over time, etc., to prevent gel drying Effect

Inactive Publication Date: 2019-04-02
MITSUBISHI CHEM CORP
View PDF8 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Among them, especially in the DNA chip using the gel, the effect of drying causes deterioration of the gel over time, and there is a possibility that the hybridization reaction of the nucleic acid probe is hindered.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Composition for preventing drying of gel, gel composite and DNA chip containing said composite, and method for producing said composition, composite, and chip
  • Composition for preventing drying of gel, gel composite and DNA chip containing said composite, and method for producing said composition, composite, and chip
  • Composition for preventing drying of gel, gel composite and DNA chip containing said composite, and method for producing said composition, composite, and chip

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0106] 1. Preparation of Gels for Diffusion Impregnation of Nucleic Acid Probes

[0107] First, a gel used in diffusion impregnation of nucleic acid probes is prepared. The following table gives the raw materials and their amounts used in the preparation.

[0108] [Table 1]

[0109] Table 1a

[0110]

[0111] Table 1b

[0112]

[0113] Table 1c

[0114]

[0115]In the table, DMAAm represents N,N-dimethylacrylamide (manufactured by Sigma-Aldrich), MBAAm represents N,N-methylenebisacrylamide (manufactured by Sigma-Aldrich), VA-044 represents 2, 2′-bis(2-imidazolin-2-yl)[2,2′-azobispropane]·2 hydrochloride (manufactured by Wako Pure Chemical Industries, Ltd.), and ultrapure water means Milli Q water.

[0116] Initially, a monomer solution and a polymerization initiator solution were prepared according to the ratios shown in Table 1a and Table 1b, respectively. Next, these solutions were measured according to the weights described in Table 1c, and mixed with glyceri...

Embodiment 2

[0128] In the same manner as the method described in JP-A-2006-189307, a through-hole DNA chip in which about 3.8% by mass of N,N-dimethylacrylamide gel was formed into dots was fabricated. As the probe of the DNA chip, the mouse version probe of the anti-aging chip manufactured by Mitsubishi Rayon Co., Ltd. was used.

[0129] In order to immerse the DNA chip in the glycerin-gelatin gel solution composition, a draining container capable of accommodating a plurality of DNA chips and draining each plate with a centrifuge was prepared.

[0130]

[0131] About 50 mL of a glycerin gelatin gel solution composition having the same composition as in Example 1 was prepared, poured into the container shown in FIG. 8 , and dipped the part of the DNA chip including the region where the nucleic acid probe array and immobilized gel existed at 60° C. specified time. Thereafter, the container was tilted, the glycerin-gelatin gel solution composition was discarded, and the excess gel soluti...

Embodiment 3

[0144] A DNA chip for determining a single base mutation of the KRAS gene is produced. The sequences used in the probes are the 14 sequences shown in the table below.

[0145] [Table 2]

[0146] WT

TTGGAGCTGGTGGCGTA

serial number 1

mt1

TTGGAGCTAGTGGCGTA

serial number 2

mt2

TTGGAGCTCGTGGCGTA

serial number 3

mt3

TTGGAGCTTGTGGCGTA

serial number 4

mt4

TTGGAGCTGATGGCGTA

serial number 5

mt5

TTGCAGCTGCTGGCGTA

serial number 6

mt6

TTGGAGCTGTTGGCGTA

serial number 7

mt7

TGGAGCTGGTAGCGTAGGCAA

serial number 8

mt8

TGGAGCTGGTCGCGTAGGCAA

serial number 9

mt9

TGGAGCTGGTTGCGTAGGCAA

serial number 10

mt10

GGAGCTGGTGACGTAGGCAAG

serial number 11

mt11

GGAGCTGGTGCCGTAGGCAAG

serial number 12

mt12

GGAGCTGGTGTCGTAGGCAAG

serial number 13

N.C.

ATTAGGGTCGAACCTACACGACAATGCACG

serial number 14

...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides: a composition for preventing the drying of gel with which it is possible to prevent the drying of gel more easily than in the past; a gel complex and a DNA chip containing saidcomposite; and a method for producing said composition, composite, and chip. This problem can be overcome by a composition for preventing the drying of gel that includes a polyhydric alcohol and at least one selected from gelatin, collagen, carrageenan, pectin, and agar.

Description

technical field [0001] The present invention relates to a composition for preventing gel drying, a gel complex, a DNA chip containing the same, and a method for producing the same. Further, the present invention also relates to a DNA chip anti-drying method. Background technique [0002] As a material capable of holding solvent hundreds or thousands of times its own weight, gel has been used in superabsorbent resins, diapers, sanitary products, soft contact lenses, and water-containing sheets for indoor greening. In addition, it also has sustained-release properties of drugs, and is also used in medical materials such as drug delivery systems and wound covering materials. Furthermore, it is also used in shock absorbing materials, shock absorbers, sound insulating materials, etc., and its uses are various. [0003] In addition, the gel is also used to hold or coat polynuclear cells loaded as nucleic acid probes (also simply called "probes") in a DNA chip (sometimes called "...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/09C12M1/00C12Q1/6837G01N33/53G01N37/00
CPCC12N15/09C12Q1/6837G01N37/00C12Q2527/125C12M1/34C12N15/10C12Q1/6874C12Q2563/159
Inventor 外川直之
Owner MITSUBISHI CHEM CORP