Check patentability & draft patents in minutes with Patsnap Eureka AI!

Plant constitutive promoter alspro and its application

A constitutive promoter and promoter technology, applied in the field of agricultural biology, can solve problems such as silencing of transgenes, and achieve the effects of reducing potential safety risks, being conducive to commercial applications, and having good market value and social benefits.

Active Publication Date: 2021-08-17
HAINAN BOLIAN RICE GENE TECH CO LTD
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

CaMV35Spro is the promoter of plant DNA virus, and its application in plant transgenesis may cause public concern; although ZmUbipro is of plant origin, frequent use of the same promoter during transformation can easily lead to transgene silencing

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Plant constitutive promoter alspro and its application
  • Plant constitutive promoter alspro and its application
  • Plant constitutive promoter alspro and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0063] The acquisition of embodiment 1 promoter ALSpro

[0064]The bioinformatic analysis of the upstream sequence of the gene encoding acetolactate synthase (ALS; EC2.2.1.6) through the activation function prediction software PlantCARE and PlantPAN found that the sequence is rich in a variety of promoter-related sequences. Functional elements such as CAAT-box, TATA-box, etc., indicating that the sequence has the structural characteristics of a plant cell promoter. And by PlantPAN analysis, its 1263-2180 sequence is rich in CpG islands, and CpG islands are also one of the sequence characteristics of eukaryotic promoters. It is speculated that this sequence may have promoter activity, and its core sequence is the 1263-2180 region.

[0065] The upstream sequences of the ALS gene of different lengths were intercepted to identify the promoter activity. After continuous screening and comparison, the sequence shown in SEQ ID NO.1 and SEQ ID NO.2 was finally determined as the promote...

Embodiment 2

[0072] Expression analysis of embodiment 2 promoter ALSpro

[0073] Use qPCR (fluorescence quantitative PCR) to identify the expression pattern of ALSpro downstream genes, the specific method is as follows:

[0074] The roots, leaves, young panicles, seedlings and calluses of ZH11 were taken respectively, total RNA was extracted, and cDNA was obtained by reverse transcription. In the Thermo PikoReal96 real-time fluorescent quantitative PCR system, Actin gene was used as an internal reference to detect the expression of ALS gene downstream of ALSpro.

[0075] qPCR primer sequences:

[0076] OsALSWT-qRtF2: GCACAATGAGTTGGACCAGCAG (SEQ ID NO. 11)

[0077] OsALSWT-qRtR2:GTCAGCTCATCCAGCACCTGAA (SEQ ID NO. 12)

[0078] Actin-F: AGCATGAAGATCAAGGTGGTC (SEQ ID NO. 13)

[0079] Actin-R: GCCTTGGCAATCCACATC (SEQ ID NO. 14)

[0080] The qPCR reaction system and procedure of ALS gene are as follows:

[0081] Program: Pre-denaturation at 94°C for 7 minutes, denaturation at 94°C for 15s,...

Embodiment 3

[0087] Embodiment 3 constructs the plant transgenic expression cassette and vector containing promoter ALSpro

[0088] 1. Preparation of a plant transgenic expression cassette containing promoter ALSpro (2180, SEQ ID NO.1)

[0089] The construction method of the plant transgenic expression cassette ALSpro2180-ALSm1-OsUbiT (sequence such as SEQ ID NO.7) of the present invention is as follows:

[0090] The primers 0310-AAU-F / 0310-AAU-Rv1 were designed to amplify the promoter OsALSP fragment from the rice genome; The ALSm1 fragment of the target gene was amplified; the terminator OsUbiT fragment was amplified from the rice genome using primers 0310-AAU-F3 / 0310-AAU-Rv. Among them, the 5' ends of primers 0310-AAU-F and 0310-AAU-Rv have about 15 nucleotide sequences repeated with the corresponding connection positions of the vector; the 5' ends of the upstream and downstream primers of adjacent fragments also have 15 bp repeats (0310- AAU-Rv1 and 0310-AAU-F2, 0310-AAU-Rv2 and 0310...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of agricultural biotechnology, in particular to a plant constitutive promoter ALSpro and its application. The nucleotide sequence of the promoter ALSpro of the present invention is shown in SEQ ID NO.1 or SEQ ID NO.2. It is an endogenous constitutive promoter in rice, which can drive genes in callus and leaves in the vegetative growth period, etc. Efficient and stable expression in various tissues and reproductive organs can replace non-plant-derived promoters, which is very beneficial to the genetic engineering of plants such as rice, and can effectively reduce the potential safety risks of transgenic plants caused by exogenous DNA.

Description

technical field [0001] The invention relates to the field of agricultural biotechnology, in particular to a plant constitutive promoter ALSpro and its application. Background technique [0002] Transgenic technology has become one of the indispensable technologies in the fields of basic research and applied research such as gene function research. As an important functional cis-acting element driving gene expression, promoter occupies an important position in transgenic technology. Promoters can be divided into constitutive promoters, inducible promoters and space-time specific promoters according to their expression modes. Constitutive promoters can initiate gene transcription in all or most tissues, making gene expression have temporal and spatial continuity and expression constancy. Inducible promoters can start or greatly increase gene expression under the stimulation of certain physical or chemical signals. They have sequence structures of enhancers, silencers or simi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/113C12N15/82C12N15/11A01H5/00A01H6/46
CPCC12N9/1022C12N15/8223C12N15/8274C12N2830/008C12Y202/01006
Inventor 安保光欧阳超陈思兰李丹李新鹏龙湍曾翔吴永忠黄培劲
Owner HAINAN BOLIAN RICE GENE TECH CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More