Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Plant constitutive promoter OsUbipro and application thereof

A constitutive promoter and promoter technology, applied in the field of agricultural biology, can solve problems such as transgene silencing

Active Publication Date: 2020-08-21
HAINAN BOLIAN RICE GENE TECH CO LTD
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

CaMV35Spro is the promoter of plant DNA virus, and its application in plant transgenesis may cause public concern; although ZmUbipr is of plant origin, frequent use of the same promoter during transformation can easily lead to transgene silencing

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Plant constitutive promoter OsUbipro and application thereof
  • Plant constitutive promoter OsUbipro and application thereof
  • Plant constitutive promoter OsUbipro and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0056] The acquisition of embodiment 1 promoter OsUbipro

[0057] The bioinformatic analysis of the upstream sequence of OsUbi gene (SEQ ID NO.1) about 1756bp sequence (SEQ ID NO.1) by the promoter function prediction software PlantCARE and PlantPAN found that the sequence is rich in various promoter-related cis-acting elements such as CAAT-box , TATA-box, etc., indicated that the sequence of SEQ ID NO.1 has the structural characteristics of a plant cell promoter. And analyzed by PlantPAN, its 375-1256bp sequence is rich in CpG islands, and CpG islands are also one of the sequence characteristics of eukaryotic promoters, so it is speculated that this sequence should have promoter activity, and its core sequence is a 375-1256bp region .

[0058] The upstream sequences of the OsUbi gene of different lengths were intercepted to identify the promoter activity. After continuous screening and comparison, the sequence shown in SEQ ID NO.1 was finally determined as the promoter seque...

Embodiment 2

[0062] Expression analysis of embodiment 2 promoter OsUbipro

[0063] Using qPCR (fluorescent quantitative PCR) to identify the expression pattern of OsUbipro downstream genes, the specific method is as follows:

[0064] The roots, leaves, young panicles, seedlings and calluses of ZH11 were taken respectively, total RNA was extracted, and cDNA was obtained by reverse transcription. In the Thermo PikoReal96 real-time fluorescent quantitative PCR system, the expression of the OsUbi gene downstream of OsUbipro was detected using the Actin gene as an internal reference.

[0065] RT-PCR primer sequences:

[0066] OsUbi-qRtF2: GGCCGCACCTTGGCTGACTA (SEQ ID NO. 6)

[0067] OsUbi-qRtR2: GATCTGCATCCCACCCCTGA (SEQ ID NO. 7)

[0068] Actin-F: AGCATGAAGATCAAGGTGGTC (SEQ ID NO. 8)

[0069] Actin-R: GCCTTGGCAATCCACATC (SEQ ID NO. 9)

[0070] Fluorescent quantitative PCR reaction system and procedures are as follows:

[0071] Program: pre-denaturation at 94°C for 7 minutes, denaturation...

Embodiment 3

[0076] Embodiment 3 constructs the plant transgenic expression cassette and vector containing promoter OsUbipro

[0077] 1. Preparation of plant transgenic expression cassette containing promoter OsUbipro

[0078] The construction method of the plant transgenic expression cassette OsUbip-ALSm-OsUbiT (sequence such as SEQ ID NO.4) of the present invention is as follows:

[0079] Primers 0310-UAU-F / 0310-UAU-Rv1 were designed to amplify the promoter OsUbip fragment from the rice genome; The target gene ALSm1 fragment was amplified; the terminator OsUbiT fragment was amplified from the rice genome using primers 0310-UAU-F3 / 0310-UAU-Rv. Among them, the 5' ends of primers 0310-UAU-F and 0310-UAU-Rv have about 15 nucleotide sequences repeated with the corresponding connection positions of the vector; the 5' ends of the upstream and downstream primers of adjacent fragments also have 15 bp repeats (0310- UAU-Rv1 and 0310-UAU-F2, 0310-UAU-Rv2 and 0310-UAU-F3) for subsequent recombinat...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of agricultural biology, in particular to a plant constitutive promoter OsUbipro and application thereof. The nucleotide sequence of the promoter OsUbiprodisclosed by the invention is as shown in SEQ ID NO. 1. The promoter OsUbipro disclosed by the invention is a rice endogenous source constitutive promoter; the promoter can drive efficient and stableexpression of genes in plant calluses and leaves in the vegetative growth period, especially seedlings in the 3-5-leaf period, reproductive organs and other tissues, can replace non-botanical promoters, is very beneficial to genetic engineering of rice and other plants, and can effectively reduce the potential safety risk of transgenic plants caused by exogenous DNA.

Description

technical field [0001] The invention relates to the field of agricultural biotechnology, in particular to a plant constitutive promoter OsUbipro and its application. Background technique [0002] Transgenic technology has become one of the indispensable technologies in the fields of basic research and applied research such as gene function research. As an important functional cis-acting element driving gene expression, promoter occupies an important position in transgenic technology. Promoters can be divided into constitutive promoters, inducible promoters and space-time specific promoters according to their expression modes. Constitutive promoters can initiate gene transcription in all or most tissues, making gene expression have temporal and spatial continuity and expression constancy. Inducible promoters can start or greatly increase gene expression under the stimulation of certain physical or chemical signals. They have sequence structures of enhancers, silencers or si...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12N15/82C12N15/65C12N1/21C12N15/11A01H4/00A01H5/00A01H6/46A01H6/54A01H6/60A01H6/20
CPCA01H4/00C07K14/415C12N15/65C12N15/8222C12N15/8225C12N15/8227C12N15/823
Inventor 欧阳超安保光陈思兰赵惠敏李丹李新鹏龙湍曾翔吴永忠黄培劲
Owner HAINAN BOLIAN RICE GENE TECH CO LTD
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More