Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Wheat disease resistance and heading regulating gene tacok and its related biomaterials and applications

A biomaterial and genetic technology, applied in the fields of application, genetic engineering, plant genetic improvement, etc., can solve problems such as lack and slow progress

Active Publication Date: 2021-11-16
INST OF CROP SCI CHINESE ACAD OF AGRI SCI
View PDF11 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, conventional breeding methods have been slow to breed sheath blight-resistant wheat varieties due to the lack of readily available germplasm of wheat germplasm resistant to sheath blight

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Wheat disease resistance and heading regulating gene tacok and its related biomaterials and applications
  • Wheat disease resistance and heading regulating gene tacok and its related biomaterials and applications
  • Wheat disease resistance and heading regulating gene tacok and its related biomaterials and applications

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0110] The preparation method of the toothpick covered with Rhizoctonia graminearum: Put the toothpick section upright and stuff it into a small beaker, prepare MS liquid medium, pour it into the small beaker of the toothpick section, and put the preserved Rhizoctonia graminearum into the small beaker after sterilization. The mycelium block was inoculated into a beaker and incubated at a constant temperature of 25°C until the mycelium was densely covered with a toothpick.

[0111] Preparation method of fungus wheat grains covered with Rhizoctonia graminearum: prepare MS liquid medium, after sterilization, inoculate the mycelial block of newly cultivated Rhizoctonia graminearum into a triangular flask, and cultivate at a constant temperature of 25°C until the bacteria The silk is dense; then soak the wheat grains for 5-6 hours and boil for 20 minutes, fill up a 250-500 ml triangular flask, insert the dense mycelia liquid on it, shake well, and cultivate at a constant temperature...

Embodiment 1

[0112] Example 1. Cloning of wheat protein TaCOK resistant to sheath blight and its coding gene and its expression analysis induced by sheath blight

[0113] 1. Cloning of wheat protein TaCOK resistant to sheath blight and its coding gene

[0114] The inventors of the present invention isolated and cloned a disease resistance related wheat protein from sheath blight resistant wheat germplasm CI12633, the amino acid sequence of which is shown in SEQ ID No.2, and named it TaCOK protein. The gene encoding TaCOK protein is named TaCOK gene, and its nucleotide sequence is shown in SEQ ID No.1.

[0115] The specific cloning method is as follows:

[0116] Total RNA was extracted from the stems of wheat CI12633 inoculated with Rhizoctonia cerealis WK207 hyphae, and the extracted RNA samples were reverse-transcribed to synthesize the first-strand cDNA synthesis kit according to the procedure of Invitrogen's first-strand cDNA synthesis kit. A strand of cDNA was used as a template for ...

Embodiment 2

[0129] Example 2. Obtaining, molecular and disease resistance identification of transgenic TaCOK wheat resistant to sheath blight

[0130] 1. Construction of recombinant expression vector

[0131] Construct the complete ORF sequence of TaCOK gene into pWMB123, the specific operation is as follows:

[0132] 1. Use a primer pair consisting of TaCOK-TV-F and TaCOK-TV-R.

[0133] TaCOK-TV-F: 5′- TTCTGCAGGTCGACTCTAGA ATGGAGAAGACGACAGGGAT-3' (the sequence indicated by the underline is the homologous sequence of the vector);

[0134] TaCOK-TV-R: (The sequence indicated by the underline is the homologous sequence of the vector, and the sequence indicated by the box is the 6×His tag coding sequence).

[0135] 2. Using the DNA fragment shown in SEQ ID No.1 as a template, the primer pair consisting of TaCOK-TV-F and TaCOK-TV-R is used for PCR amplification under the action of the high-fidelity amplification enzyme PRIMERSTAR (TAKARA company) , to obtain the PCR amplification pro...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a wheat disease resistance and earing regulating gene TaCOK and related biological materials and applications thereof. TaCOK is any of the following proteins: A1) the protein whose amino acid sequence is shown in SEQ ID No.2; A2) the amino acid sequence defined by A1) undergoes substitution and / or deletion and / or addition of one or several amino acid residues The obtained protein has more than 90% identity with the protein shown in A1) and is related to plant disease resistance; A3) A fusion protein obtained by linking tags at the N-terminal or / and C-terminal of A1) or A2). The TaCOK and its encoding gene provided by the present invention can be used to improve plant disease resistance and regulate the expression of vernalization genes and vernalization-related genes, thereby regulating plant heading, which is useful for cultivating new plant varieties that are disease-resistant and have wide adaptability is of great significance.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to the wheat disease resistance and heading regulating gene TaCOK and related biological materials and applications. Background technique [0002] Wheat is one of the important staple food crops of the world and our people. More than 40% of the world's population uses wheat as a staple food crop, so wheat plays a pivotal role in ensuring food security. With the increase of planting density, changes in fertilizer and water conditions and farming systems, wheat sheath blight has developed into a major disease of wheat production in my country, and has become an important limiting factor for high and stable wheat yields in my country. Wheat sheath blight, also known as wheat sharp eyespot, is mainly caused by saprotrophic trophic fungus Rhizoctonia cerealis CAG-1 in China. Sheath blight can generally reduce wheat production by 10% to 30%, and severe plots can reduce wheat production by m...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/415C12N15/29C12N15/82A01H5/00A01H5/10A01H6/46
CPCC07K14/415C12N15/8261C12N15/8282
Inventor 张增艳王开郭飞龙王珂祝秀亮
Owner INST OF CROP SCI CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com