Unlock instant, AI-driven research and patent intelligence for your innovation.

Application of DNA tetrahedron in preparation of medicine for treating and preventing periodontitis

A tetrahedral, periodontitis technology, applied in the field of nucleic acid drugs, to achieve excellent clinical application prospects, good patient compliance, and obvious protective effect

Pending Publication Date: 2021-02-12
SICHUAN UNIV
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There is no report on the treatment of periodontitis by DNA tetrahedron

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of DNA tetrahedron in preparation of medicine for treating and preventing periodontitis
  • Application of DNA tetrahedron in preparation of medicine for treating and preventing periodontitis
  • Application of DNA tetrahedron in preparation of medicine for treating and preventing periodontitis

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Example 1 Synthesis and Identification of DNA Tetrahedron

[0029] 1. Synthesis method

[0030] Dissolve four single-stranded DNA (ssDNA) S1, S2, S3, S4 in TM Buffer (10mM Tris-HCl, 50mMMgCl 2 ,pH=8.0), so that the final concentration of the four single-stranded DNA is 1000nM, mix well, heat quickly to 95°C and keep it for 10 minutes, then quickly cool down to 4°C and keep it for more than 20 minutes, you can self-assemble to get DNA four-sided body, the principle is as figure 1 as shown in a.

[0031] The sequences of the four single strands (5'→3') are as follows:

[0032] S1:

[0033] ATTTATCACCCGCCATAGTAGACGTATCACCAGGCAGTTGAGACGAACATTCCTAAGTCTGAA (SEQ ID NO. 1)

[0034] S2:

[0035] ACATGCGAGGGTCCAATACCGACGATTACAGCTTGCTACACGATTCAGACTTAGGAATGTTCG (SEQ ID NO. 2)

[0036] S3:

[0037] ACTACTATGGCGGGTGATAAAACGTGTAGCAAGCTGTAATCGACGGGAAGAGCATGCCCATCC (SEQ ID NO. 3)

[0038] S4:

[0039] ACGGTATTGGACCCTCGCATGACTCAACTGCCTGGTGATACGAGGATGGGCATGCTCTTCCCG (SEQ ID NO. ...

experiment example 1

[0043] Experimental example 1 The therapeutic effect of DNA tetrahedron on periodontitis

[0044] 1. Method

[0045] The animal model of periodontitis was established by wrapping the maxillary second molars of 8-10 week-old male SD rats with 3-0 silk thread for 3 weeks.

[0046] After the thread was tied on the day of modeling, 20 microliters of DNA tetrahedron with a concentration of 250 nM and 500 nM was injected into the palatal mucosa of the rats' maxillary second molars in the experimental group, and the same volume of saline was injected in the control group. The two groups were injected once a day, and the corresponding rats were killed 21 days after the injection of the drug, and the maxillary tissue samples were collected for testing:

[0047] (1) The collected maxillary bone tissue was fixed and micro-CT (micro-CT) scanning was performed to analyze the changes of alveolar bone resorption.

[0048] (2) The collected maxillary bone tissue was fixed, dehydrated, embed...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses application of a DNA tetrahedron in preparation of a drug for treating and preventing periodontitis, and belongs to the field of nucleic acid drugs. The DNA tetrahedron is usedfor treating periodontitis, has an excellent effect, and has a better curative effect than common antibiotics for treating periodontitis. The invention provides a true therapeutic drug for clinicallytreating periodontitis, provides a brand-new direction for periodontitis treatment, and has a good application prospect.

Description

technical field [0001] The invention belongs to the field of nucleic acid medicine. Background technique [0002] Periodontitis is a common inflammatory and destructive disease caused by bacterial plaque. Without intervention, there will be risks such as bleeding gums, alveolar bone resorption, and loose teeth, which will greatly affect people's quality of life. In addition, it can also induce or aggravate a variety of systemic chronic inflammatory diseases, such as diabetes, cardiovascular disease, and chronic kidney disease, by locally releasing a large number of inflammatory factors into the blood circulation or causing odontogenic bacteremia , stroke, etc. Related studies have reported that treatment and control of periodontal inflammation can greatly reduce the risk of tooth loosening and loss and effectively improve the treatment effect and prognosis of the above-mentioned systemic diseases. Therefore, the prevention and treatment of periodontitis has great applicat...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K31/711A61P1/02
CPCA61K31/711A61P1/02
Inventor 林云锋周蜜蔡潇潇
Owner SICHUAN UNIV