A chitosanase gene derived from Clostridium and its recombinant bacteria and its application in the production of chitosan oligosaccharides
A chitosanase and recombinant bacteria technology, applied in the field of bioengineering, can solve problems such as unproven, large amount of enzyme preparation, poor specificity, etc., and achieve high economic value and industrial application prospects, enzyme thermal stability and pH. Good stability and high catalytic activity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0045] Example 1: Obtaining of Enzyme Gene and Construction of Recombinant Plasmid
[0046] Through the NCBI comparison results, it was found that the Clostridium strain screened from the strawberry rhizosphere soil has potential chitosanase genes. Select the chitosanase gene with high homology as the target sequence, design primers
[0047] csE-F:AGTAAAACAAAGATGAAAAATTTACGA
[0048] csF-R: ATAAACATCACCATCATTATTGGGATT
[0049] The target gene sequence csE (SEQ ID NO: 2) was amplified by taking the genomic DNA from Clostridium as a template, so as to obtain the chitosanase gene fragment of the present invention from the bacteria. The total volume of the reaction system is 50 μL, 25 μL of 2×TaqMax Master Mix, 2 μL of plasmid template, 1 μL of upstream primer, 1 μL of downstream primer, ddH 2 O 21 μL. The PCR amplification reaction program was firstly denatured at 94°C for 3 min, followed by denaturation at 94°C for 1 min, annealing at 55°C for 1 min, and extension at 72°C fo...
Embodiment 2
[0050] Example 2 Construction of recombinant Escherichia coli engineering bacteria containing the chitosanase gene A tube of Escherichia coli Trans1-T1 (purchased from Novizan Biotechnology Co., Ltd.) competent cells was taken from a -80°C refrigerator and placed on ice Thaw; add 10 μL of the above ligation product, mix gently and then ice bath for 30 min; heat the above mixture in a water bath at 42 °C for 90 s, then immediately place it on ice for 5 min; add 800 μL LB medium, incubate at 37 °C for 1 h, and centrifuge at 5000 rpm for 10 min , remove the supernatant, and resuspend the pellet; take an appropriate amount of the above mixture and spread it on LB (containing kanamycin 25 μg / mL and chloramphenicol 25 μg / mL) plate, invert overnight at 37 ° C to pick transformants, and then The plasmid was extracted and verified by PCR to obtain the recombinant strain E.coli Trans1-T1 / pTrc99a-csE.
Embodiment 3
[0051] Example 3 Determination of chitosanase enzymatic activity
[0052] (1) High-density inducible expression of chitosanase
[0053] The E.coli Trans1-T1 / pTrc99a-csE successfully transferred into the chitosanase gene was cultured on LB plate at 37°C overnight, and a single colony was picked and inoculated into fresh LB (containing 25 μg / mL kanamycin and chloramphenicol). 25 μg / mL) medium, shake overnight at 37°C. It was inoculated into the fermentation medium containing kanamycin and chloramphenicol with an inoculum of 2%, wherein the fermentation medium consisted of: yeast powder 5g / L, glycerol 10g / L, peptone 15g / L, dipotassium hydrogen phosphate 8g / L, potassium dihydrogen phosphate 3g / L, magnesium sulfate 0.3g / L, ammonium sulfate 1.2g / L, incubate at 37°C until OD 600 When it reaches 0.6-0.8, reduce the temperature to 28°C, control the dissolved oxygen and pH to be 30% and 7.0, respectively, add IPTG with a final concentration of 0.3mM to induce expression for 8 hours, a...
PUM
| Property | Measurement | Unit |
|---|---|---|
| degree of polymerization | aaaaa | aaaaa |
| conversion efficiency | aaaaa | aaaaa |
| degree of polymerization | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More