A kind of PD-L1 antibody and its extraction method
A PD-L1, antibody technology, applied in the field of biomedicine or biopharmaceuticals, can solve the problems of narrow linear range and limited detection ability of PD-L1 antibody
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
specific Embodiment approach 1
[0015] Specific embodiment 1: The nucleotide sequence of the PD-L1 antibody in this embodiment is shown in SEQ ID NO.1, and the amino acid sequence of the PD-L1 antibody is shown in SEQ ID NO.2.
specific Embodiment approach 2
[0016] Specific embodiment 2: The extraction method of PD-L1 antibody in this embodiment is carried out according to the following steps: use human PD-L1 (programmed death ligand 1) full-length protein as an antigen to immunize sharks, then extract RNA, and use reverse The cDNA was reverse-transcribed into cDNA by the recording kit, and the gene encoding the vNAR region was obtained by PCR amplification, and then the PD-L1 antibody was obtained through screening, expression and purification.
specific Embodiment approach 3
[0017] Embodiment 3: This embodiment differs from Embodiment 2 in that the upstream primer for PCR library construction is: TCGCTACCGTGGCCCAGGCGGCCAACTTGAACAAACGGGCACC, and the downstream primer for library construction is:
[0018] TGATGGTGCTGGCCGGCCTGGCCTTCATGGGTCAGAATCATGC. Other steps and parameters are the same as in the second embodiment.
[0019] Specific embodiment three: the difference between this embodiment and specific embodiment two is the PCR amplification reaction conditions: 95°C for 2 minutes; 94°C for 30 seconds, 58°C for 30 seconds, 72°C for 1 minute, 35 cycles, 72°C for 10 minutes . Other steps and parameters are the same as in the second embodiment.
PUM
| Property | Measurement | Unit |
|---|---|---|
| Sensitivity | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 


