Unlock instant, AI-driven research and patent intelligence for your innovation.
CRISPR/Cas9 system for targeted knockout of glk gene and its application
What is Al technical title?
Al technical title is built by PatSnap Al team. It summarizes the technical point description of the patent document.
A target gene and gene technology, which is applied in the field of CRISPR/Cas9 system for knocking out GLK gene, can solve the problem of long required period and achieve the effect of enriching varieties
Active Publication Date: 2021-09-07
NORTHEAST FORESTRY UNIVERSITY
View PDF1 Cites 0 Cited by
Summary
Abstract
Description
Claims
Application Information
AI Technical Summary
This helps you quickly interpret patents by identifying the three key elements:
Problems solved by technology
Method used
Benefits of technology
Problems solved by technology
[0003] In the past, in the development of plant CRISPR / Cas9 site-specific editing technology, people mainly used the Agrobacterium tumefaciens mediated method to introduce the Cas9 protein-gRNA ribonucleoprotein complex (RNP) into recipient cells under the drive of T-DNA. The obtained genome edited plant host genome still contains exogenous DNA sequences (DNA sequences of A. Sexual hybridization technology can remove these foreign genes, but the required period will be longer
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more
Image
Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
Click on the blue label to locate the original text in one second.
Reading with bidirectional positioning of images and text.
Smart Image
Examples
Experimental program
Comparison scheme
Effect test
Embodiment 1B
[0027] Example 1 Prediction of pGLK gene target site and detection of gRNA activity
[0028] 1. Prediction of BpGLK gene target site and gRNA sequence design
[0029] According to the gene sequence and coding region sequence of birch BpGLK (Bpev01.c0167.g0013.m0001), the CRISPR-direct web page (http: / / crispr.dbcls.jp / ) was used to screen for specific targets. That is, find NGG (N is A, T, C or G) in the CDS region sequence of the gene, preferably AGG, and take the 20 bp in front of NGG as the target sequence in order to improve the gene knockout efficiency. Design gRNA according to the target sequence, see Table 1 for details.
[0030] Table 1 gRNA sequence
[0031]
[0032] 2. Synthesis and activity detection of gRNA
[0033] Add the T7 promoter sequence at the front end of the gRNA sequence: TAATACGACTCACTATAG; add the guide sequence GTTTAAGAGCTATGCTGGAAACAGCATAGCAAGTTTAAATAAGG (stem-loop structure) at the back end of the gRNA sequence; use the primers for gRNA synthes...
Embodiment 2
[0053] Example 2 BpGLK gene editing mediated by gene gun
[0054] 1. Preparation of gene gun particles (the following operation steps can bombard 60 guns according to the amount of 500 μg per gun)
[0055] (a) Add 30mg of 1.0μm Gold Microcarriers into Eppendorf tubes.
[0056] (b) Add 1ml of 70% alcohol, vortex fully, let stand for 15min, and centrifuge at 1500rpm for 5min.
[0057] (c) Discard the supernatant, add 1ml of sterile water, vortex well, centrifuge at 1500rpm for 5min, and repeat 3 times.
[0058] (d) Add 1 ml of 50% glycerin, and the final concentration reaches 60 mg / ml at this time, and store at 4°C.
[0059] 2. Package of CRISPR / Cas9 (RNP) (the amount below is enough for 6 shots, adjust the amount as needed)
[0060] (a) Vortex the above-prepared Gold Microcarriers mother solution for 5 minutes to break up agglomerated particles. It should be noted that the particles are easy to sink, and the resuspended particles must be re-oscillated every time the gun is ...
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
PUM
Login to View More
Abstract
The invention discloses a CRISPR / Cas9 system for targeted knockout of GLK gene and its application, belonging to the technical field of molecular biology. Through design, construction, and screening, the present invention finally provides some high-efficiency gRNA and target site sequences based on the CRISPR / Cas9 system that can target the birch GLK gene. Specifically, the white birch GLK gene is used as the editing target gene, and the in vitro purified Cas9 protein The ribonucleoprotein complex RNP mixed with GLK-gRNA was used to bombard the callus of birch with microparticles, and the gene editing technology without T-DNA insertion was preliminarily established. Using this gene editing technology, the yellow-leaf plants of birch were obtained, which is an important method for enriching birch varieties. And the rapid creation of birch plant mutants provides a new idea.
Description
technical field [0001] The invention relates to the technical field of molecular biology, and relates to a CRISPR / Cas9 system for knocking out GLK gene and its application. Background technique [0002] GLK transcription factors promote the expression of many nuclear-encoded photosynthesis genes involved in chlorophyll biosynthesis. The GLK gene has been involved in the regulation of chloroplast development in Arabidopsis and the moss Physcomitrella patens. In addition, ectopic expression of GLKs can induce increased chloroplast production in non-green tissues such as Arabidopsis, rice root and callus, and increase the number of cellular chloroplasts in tomato, indicating the important role of GLKs in plastid development. Huixin et al. conducted a more in-depth study on the function of the BpGLK gene, mainly identified the phenotype and mutant gene of the T-DNA insertion mutant strain, summarized the T-DNA integration mode, studied the function of the mutant gene BpGLK, and...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
Application Information
Patent Timeline
Application Date:The date an application was filed.
Publication Date:The date a patent or application was officially published.
First Publication Date:The earliest publication date of a patent with the same application number.
Issue Date:Publication date of the patent grant document.
PCT Entry Date:The Entry date of PCT National Phase.
Estimated Expiry Date:The statutory expiry date of a patent right according to the Patent Law, and it is the longest term of protection that the patent right can achieve without the termination of the patent right due to other reasons(Term extension factor has been taken into account ).
Invalid Date:Actual expiry date is based on effective date or publication date of legal transaction data of invalid patent.
Login to View More 
Login to View More