Application of SDX in preparation of male infertility detection kit

A technology for male infertility and detection kits, applied in the field of biomedical detection, can solve problems such as complex genetic background

Active Publication Date: 2021-11-05
WUHAN UNIV
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Idiopathic sex reversal disorder (XY female) has a complex genetic background, most of which are caused by gene mutations. Since the 1990s, scientists discovered that the SRY (Sex-determining Region on the Y chromosome) gene mutation can lead to complete

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of SDX in preparation of male infertility detection kit
  • Application of SDX in preparation of male infertility detection kit
  • Application of SDX in preparation of male infertility detection kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] 1. Construction of SDX gene-deficient mouse model

[0037] Methods: Using CRISPR / Cas9 technology, through the principle of homologous recombination, the target gene was knocked out. The specific process is as follows: design and transcribe guide RNA (gRNA) in vitro.

[0038] gRNA1: ACCCCCACATATGATCCTCA (as shown in SEQ ID NO.4);

[0039] gRNA2: CCATTTGATGACCTATTCAA (as shown in SEQ ID NO.5)

[0040] Simultaneous injection of Cas9 and gRNA into fertilized eggs of mice. The Cas9 protein binds to the target site under the guidance of the gRNA and causes a DNA double-strand break (DSB: Double-strand break), forcing the cell to perform emergency repair. Under normal conditions, cells tend to use non-homologous end joining (NHEJ: nonhomologous DNA end joining) to repair the broken double strand, thereby causing the deletion mutation of the target gene, thereby achieving the knockout of the target gene.

[0041] 2. Isolate and observe the SDX gene-deficient mice, dissect the...

Embodiment 2

[0045] 1. Fluorescence method for verifying the localization pattern of SDX protein in mouse and human testis tissue:

[0046] The testis tissues of adult male mice and humans were fixed and dehydrated respectively, embedded in NEG-50 (ThermoFisher Scientific) at -80°C after dehydration, and finally frozen into sections. The frozen sections were taken out, sealed, incubated with primary antibody, washed, incubated with secondary antibody, washed, and finally sealed with a cover glass, observed and collected images under a fluorescent microscope.

[0047] 2. Fluorescent verification of the localization pattern of SDX protein in mouse and human testis tissues:

[0048] The result is as image 3 As shown, it shows that the localization patterns of SDX protein in mouse and human testis tissues are exactly the same, and the expression of both is localized in Sertoli cells (SOX9 positive).

[0049] Therefore, considering the highly conserved protein sequences of the SDX gene in hu...

Embodiment 3

[0051] Example 3 Detection of the SDX gene sequence in the genome

[0052] 1. Materials

[0053] 200 microliters (μl) of peripheral blood were collected from patients with idiopathic sex reversal (XY female) and absence of seminal vesicles in males, as well as age-dependent male infertility.

[0054] 2. Genome extraction from blood tissue

[0055] Use the blood gene extraction kit (brand: TIANGEN, product number: DP304), and perform specific operations according to the instructions. The main operations are as follows:

[0056] (1) Process the blood sample (when the selected blood sample is 200ul, no processing is required).

[0057] (2) Add 20 μl Proteinase K solution and mix well.

[0058] Add 200 μl buffer GB, mix thoroughly by inversion, and place at 70°C for 10 minutes (min), the solution should become clear, and briefly centrifuge to remove the water droplets on the inner wall of the tube cap.

[0059] (3) Add 200 μl of absolute ethanol, shake and mix well for 15 seco...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides application of SDX in preparation of a male infertility detection kit. According to the application, idiopathic sex reversal (XY <female>), male seminal vesicle deletion and age-dependent male infertility are found to be related to SDX gene abnormality or SDX gene coding protein expression level abnormality. Therefore, by detecting the SDX gene sequence or the SDX protein expression level, the situation that the idiopathic sex reversal (XY <female>), the male seminal vesicle deletion and age-dependent male infertility are related to the SDX gene can be clearly judged, so that the kit has important significance in improvement of male infertility, has important research significance in diagnosis of the idiopathic sex reversal (XY <female>) and male seminal vesicle deletion caused by genetic inheritance as well as age-dependent male infertility, and further provides a basis for clinical research.

Description

technical field [0001] The invention relates to the technical field of biomedical detection, in particular to the application of SDX in the preparation of male infertility detection kits. Background technique [0002] According to the latest survey, by 2021, my country's infertility rate will be as high as 15%, while the incidence of male infertility will be as high as 10%, which is second only to cardiovascular diseases and tumors, and seriously threatens the continuation of the human race. Genetic abnormalities are one of the important causes of male infertility, involving a variety of diseases, such as non-obstructive azoospermia due to chromosomal abnormalities or gene variations can be as high as 25%. The detection of pathogenic genes can clarify the cause of male infertility, help to choose treatment drugs, and thus effectively increase the fertility rate, which is in line with my country's national policy of eugenics and postnatal care. Male patients with Disorders o...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/6883G01N33/68
CPCC12Q1/6883G01N33/689C12Q2600/156C12Q2600/158G01N2800/367C12Q1/6806C12Q1/6869
Inventor 罗孟成占军锋崔鹏
Owner WUHAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap