41 results about "Genetic heredity" patented technology

The invention discloses a breeding method of high-rice-blast-resistance rice intermediate materials, and particularly provides a method for breeding the high-rice-blast-resistance rice intermediate materials with the advantages that molecular markers are adopted for assisting the selection, and the anther culture is adopted for accelerating the stabilization. The method provided by the invention has the advantages that through the hybridization of rice-blast-resistance genes between different gene sites, the rice-blast-resistance genes are continuously polymerized, and the bred intermediate materials have very high resistance on the rice blast. The selected intermediate materials for the rice-blast-resistance gene polymerization have very prominent rice blast resistance, and can be widely used for improving the rice varieties with good integral properties but poor rice blast resistance. The interlocking between the rice-blast-resistance genes and rice-blast-sensitive genes on other gene sites is broken through anther, and the rice-blast-resistance genes are polymerized. The selected rice-blast-resistance material genes have very rich genetic backgrounds, filial generations prepared by using the selected rice-blast-resistance material genes as parents have very prominent resistance on the rice blast, and the new rice varieties with high rice blast resistance can be more easily obtained through breeding.

The invention discloses a mapping result of an eggplant fruit color epistatic gene D. The gene D is mapped in a position near a nucleotide sequence Sme2.5_00538.1 on a No.10 chromosome of the eggplant. Based on the re-sequencing result of male and female parents, an InDel molecular marker closely linked with the eggplant fruit color epistatic gene D is obtained near the nucleotide sequence Sme2.5_00538.1 of the No.10 chromosome, and is named as InDel22522; the genetic distance of the marker from the epistatic gene D is 0.61 cM. The nucleotide sequence of the molecular marker InDel 22522 in the female parent has one 29-basic-group InDel more than that in the male parent. The mapping result on the eggplant fruit color epistatic gene D provided by the invention lays the foundation for the precise positioning and cloning of the eggplant fruit color epistatic gene; the InDel 22522 molecular marker and a molecular marker amplification primer can be applied to eggplant fruit color breeding practice in a way of simplicity, convenience, high speed and high flux; the eggplant fruit color property improving process is accelerated.

The invention provides a method for determining a quantity of DNA aggregate samples (DNA pooling) during gene detection on single-gene hereditary diseases of people. The method can be applicable to efficient analysis on a large number of samples, and the cost of gene detection on the single-gene hereditary diseases of the people can be reduced remarkably. By a primer group provided by the invention, GCK-MODY sequencing and GCK gene mutation detecting of a large number of samples can be achieved.

The invention discloses a testing method of hereditary variation of CRBPI (Cellular Retinol-Binding Protein Type I) gene of chicken, which comprises the steps of: extracting a genome DNA of a chicken blood sample; carrying out PCR (Polymerase Chain Reaction) amplification on the genome DNA, wherein the sequence of an upstream primer used in PCR amplification is TAAATTTATAGTTGCGGTCAT, and the sequence of a downstream primer is AGTTCCAGGTGACGGGTGAG; and carrying out gel electrophoresis on the amplification products and photographing the amplification products, and analyzing the electrophoresisresult, wherein the polymorphism of the 14604 locus G/T of the chicken genome is relevant to the egg laying traits (such as egg yield, breeding weight, first egg weight and the like), and the selected single nucleotide polymorphism locus is used for assisting breeding and can accelerate the breeding process of poultry.

The invention discloses a method for auxiliary detection of growth and carcass traits of cattle by heritable markers of a cattle SERPINA3 gene and an application thereof. A whole genome DNA of the cattle to be tested is used as a template, a part of fragments of the cattle SERPINA3 gene are amplified by PCR, and genetic heritable variation detection is performed by a PCR-RFLP technology. The detection method is simple and fast, low in cost, and accurate and reliable in detection results, is suitable for large-scale genotyping of genetic heritable mutation loci of the cattle SERPINA3 gene, provides new heritable markers for molecular marker assistant selection of the growth and carcass traits of the cattle, thereby speeding up the establishment of cattle populations with excellent heritableresources.

The invention discloses a method for detecting bovine growth and carcass traits with assistance of a TNNI1 gene and a special kit. The to-be-detected bovine whole genome DNA is adopted as a template; the TNNI1 gene is subjected to PCR amplification; the detection and the rapid typing of genetic vibration of the gene are performed through a PCR-RFLP technology of artificially introducing a restriction enzyme cutting site. The method disclosed by the invention has the advantages of simplicity, low cost and accurate and reliable detection result, is suitable for large-scale genotyping of the genetic vibration site of the bovine TNNI1 gene and can be applied to the molecular marker-assisted selection of the bovine growth and carcass traits to achieve an aim of quickly establishing a bovine population with good genetic resources.

The invention discloses a determination method of a rock uniaxial compressive strength empirical formula. The method comprises the following steps: firstly, collecting an L-shaped Schmidt hammer rebound value and rock uniaxial compressive strength experimental data; and then, achieving chromosome sequence hybridization and variation composed of mathematical symbols, fitting coefficients and L-type Schmidt hammer springback values through a genetic expression algorithm, and determining whether the gene sequences are eliminated or not according to the adaptive value of each chromosome gene sequence, therefore, an empirical formula which can best represent the L-shaped Schmidt hammer rebound value and the rock uniaxial compressive strength is continuously iterated. The method overcomes the subjectivity in the determination process of a traditional empirical formula, and the determined empirical formula can be suitable for determining the uniaxial compressive strength of the rock and is wide in application range.

The invention provides a construction method and device for a cerebral apoplexy multi-gene genetic risk comprehensive score (metaPRS) and the application thereof. The construction method of the cerebral apoplexy multi-gene genetic risk comprehensive score (metaPRS) comprises the following steps: screening a set of SNP (Single Nucleotide Polymorphism) related to cerebral apoplexy or cerebral apoplexy related phenotypes; detecting the genotype of the to-be-detected SNP of the individual; respectively extracting dangerous alleles, effect values and P values of the detected SNP corresponding to a plurality of sub-phenotypes from a whole genome correlation research result, constructing a plurality of candidate sub-phenotype PRSs, and screening an optimal sub-phenotype PRS; determining the weight of each sub-phenotype PRS; the weight of the subphenotype PRS is converted into the weight of the SNP level; constructing a comprehensive score metaPRS of the multi-gene genetic risk of the cerebral apoplexy; and evaluating the effect of metaPRS on cerebral apoplexy risk prediction and layering. The method is of great significance to assessment of cerebral apoplexy onset risk.

The invention discloses a preparation method of an anti-African swine fever cloned pig and belongs to the field of animal genetic engineering and genetic modification. A CRISPR/Cas9 gene knock-in technology is used, a CRISPR/Cas9 targeting vector and a pig Rosa26 gene donor vector are jointly transferred into a pig fibroblast to obtain a positive cell clone, a first intron of the pig Rosa26 gene in the positive clone is knocked in a gene capable of expressing sgRNA-Cas9 of a specific targeted knockout virus pE248R gene, such that the pE248R gene is knocked out in a targeted manner when viruses are propagated in vivo and a pig has ASFV resistance; a cloned embryo is obtained through a somatic cell nuclear transfer technology; and the cloned embryo are transferred into a pig uterus for pregnancy to obtain a cloned pig. The sgRNA-Cas9 system is knocked into a pig body for the first time and stably expressed to obtain ASFV resistance, such that a foundation is laid for breeding research on African swine fever resistance.

The invention discloses an InDel molecular marker closely linked with a gene of rice in a heading stage and an application. The molecular marker IN2 has an upstream primer sequence of SEQ ID NO. 2 anda downstream primer sequence of SEQ ID NO. 3. The invention discloses the application of the InDel molecular marker IN2 in genetic analysis and fine gene mapping of the rice in the heading period. The molecular marker IN10 has an upstream primer sequence of SEQ ID NO. 6 and a downstream primer sequence of SEQ ID NO. 7. The invention discloses the application of the InDel molecular marker IN10 ingene genetic analysis and gene fine mapping of the rice in the heading stage.

The invention relates to the field of bioinformatics analysis, and particularly provides a hereditary aortic disease (HTAAD) mutation automatic interpretation system and a construction method thereof, and by constructing a disease-related gene genetic mutation database, automatic interpretation of diseases is realized based on interpretation specifications; compared with a traditional method, the automatic interpretation system has the advantages of being high in interpretation efficiency, good in flexibility, high in sensitivity, good in specificity, high in accuracy and the like, and has a good clinical application prospect.

The invention discloses a single-gene genetic disease expansible carrier screening method and a chip. The screening method comprises the following steps: (1) estimating pathogenic mutation carrying rates of all genetic disease genes; (2) calculating the carrying rate (GCR) of a corresponding gene based on the pathogenic mutation carrying rate obtained in the step (1); and (3) calculating a gene screening grade score (GSR) based on the GCR obtained in the step (2). A variation and disease phenotype database, a gnomAD East Asian population frequency database and a large-scale Chinese female population variation frequency database are integrated to respectively calculate screening grade scores of genes of East Asian male, East Asian female and Chinese female. The method can be used as an autosomal and sex chromosome recessive genetic disease screening strategy to construct an expansible carrier screening disease list suitable for the genetic background of East Asian people or Chinese female people.