Gene GF14e and protein capable of improving rice neck blast resistance, and applications of the gene

A rice blast resistance and rice technology, applied in the field of crop genetics, to achieve the effects of enhancing rice blast panicle resistance, increasing expression, and improving rice blast resistance

Inactive Publication Date: 2016-04-20
RICE RES INST GUANGDONG ACADEMY OF AGRI SCI
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the currently known studies are basically aimed at rice leaf blast resistance, while there are very few studies on panicle blast resistance.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene GF14e and protein capable of improving rice neck blast resistance, and applications of the gene
  • Gene GF14e and protein capable of improving rice neck blast resistance, and applications of the gene
  • Gene GF14e and protein capable of improving rice neck blast resistance, and applications of the gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0020] Embodiment 1 Improving the gene of rice panicle blast resistance and the construction of overexpression vector

[0021] (1), get the seedling leaf position of Sanhuangzhan No. 2 (SHZ-2) of rice blast high-resistant variety, use TriZolReagent (Invitrogen company, its article number is: 15596026) to extract leaf total RNA, adopt formaldehyde denaturing gel electrophoresis and The purity and quantity of total RNA were detected by ultraviolet spectrophotometer;

[0022] (2) Take 1 μg of total RNA for the initial reverse transcription reaction, the reverse transcriptase used is PrimeScript (TAKARA company), and the steps of the reverse transcription reaction refer to the instructions for use of the reverse transcriptase. Using the reverse transcription product as a template, primers: F, ACGCGTCGACATATCTGGCCCAAGAGCAGTA (SEQ ID No: 3); R, GGAATTCAGGCTCACAACTGACATACCG (SEQ ID No: 4) were used for PCR amplification, and the polymerase used in PCR was KODFX (Toyobo Company). The...

Embodiment 2

[0025] Example 2 Identification of overexpression effect of GF14e gene in transgenic plants

[0026] The overexpression vector was transformed into the normal japonica rice variety Nipponbare by the method of genetic transformation mediated by Agrobacterium EHA105. Transformed primary (T 0 Generation) Through PCR and quantitative PCR detection, positive transformed plants were identified from the DNA level and RNA level, proving that the target gene GF14e has been transformed into rice, and the expression of the target gene GF14e has been increased.

[0027] In a controlled greenhouse, the transgenic positive plants were selfed to obtain the first generation of homozygous positive transgenes (T 1 Generation) strains, each strain selects 10 plants that are detected as positive by PCR to breed, and obtains T 2 generation plant, T 2 The generation strains were then tested by PCR to find out the strains derived from different T 0 T 2 There were 3 homozygous lines (5-1, 12-1, ...

Embodiment 3

[0035] Example 3 Identification of rice blast panicle blast resistance in GF14e overexpression transgenic plants

[0036] 3 homozygous overexpression transgene T in embodiment 2 2 Seeds of homozygous lines (5-1, 12-1, 12-2) and wild-type rice were germinated at 32°C, and after 2 days, the young shoots were transferred to plastic trays filled with soil for sowing, until they grew to 3 Transplant the seedlings into large plastic barrels during the leaf stage, plant 4 plants per barrel, and plant at least 10 plants for each strain. Grow naturally in the net room until the heading stage for inoculation. The rice blast strain used was Nipponbare-sensitive GD08-T13.

[0037] When the ears of rice are pulled out about 2-8cm, sow the ears of rice by hand, take a small piece of cotton and wrap the lower edge 1 / 3 of the ears of rice, and then absorb 2ml of spore liquid (1x10 6 spores / ml) was injected into the cotton, and the cotton was wrapped with tinfoil to prevent the bacterial li...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a gene GF14e and a protein which are capable of improving rice neck blast resistance, and applications of the gene. The gene has a nucleotide sequence shown as SEQ ID No:1. The rice gene GF14e is proved to be a functional gene for rice neck blast resistance for the first time. Cloning and biological function verification of the gene have great reference significance for molecular mechanism research of the rice neck blast resistance. The expression quantity of the GF14e is greatly increased after rice is transformed with a rice transformation overexpression vector over-expressing the GF14e gene, rice neck blast resistance of transformed plants is obviously improved along with the increased expression quantity, and growth states and agronomic traits of transgenic plants are hardly changed. A GF14e overexpression technique can be applied for genetic engineering breeding of rice, and can be applied to production practice to improve the rice neck blast resistance, thus ensuring rice production safety under weather conditions with frequent rice diseases at present.

Description

technical field [0001] The invention belongs to the technical field of crop genetics. More specifically, the invention relates to a gene GF14e, protein and application thereof for improving panicle blast resistance of rice. Background technique [0002] Rice blast caused by the fungus Magnaporthegrisea (Hebert) Barr is one of the most serious rice diseases in the world, and has a devastating impact on global rice cultivation. The global annual output loss due to rice blast is 11-30%, the direct economic loss is about 5 billion US dollars, and the lost grain is enough to feed 60 million people. In my country, rice blast occurs wherever rice is cultivated. The northern and southern rice fields are affected to varying degrees every year, generally with a 10-20% reduction in production, and 40-50% in severe cases, and some fields even have no harvest. [0003] At present, using the resistance of varieties to carry out rice blast resistance breeding is considered to be the most...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/29C07K14/415C12N15/82A01H5/00
Inventor刘清朱小源刘斌赵均良毛兴学王晓飞
OwnerRICE RES INST GUANGDONG ACADEMY OF AGRI SCI