Testing method and application of hereditary variation of CRBPI (Cellular Retinol-Binding Protein Type I) gene of chicken

A detection method and technology for genetic variation, applied in the field of detection of genetic variation, can solve the problems of lack of research and no genetic variation of chicken CRBP1 gene, etc.

Inactive Publication Date: 2011-07-27
SICHUAN AGRI UNIV
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] So far, there has been no research on the genetic variation of chicken CRBP1 gene at home and abroad. Due to the lack of research in the field of genetic variation of CRBP1 gene in local chicken

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Testing method and application of hereditary variation of CRBPI (Cellular Retinol-Binding Protein Type I) gene of chicken
  • Testing method and application of hereditary variation of CRBPI (Cellular Retinol-Binding Protein Type I) gene of chicken
  • Testing method and application of hereditary variation of CRBPI (Cellular Retinol-Binding Protein Type I) gene of chicken

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0023] The present invention will be described in detail below in conjunction with specific embodiments.

[0024] (1) Design of specific primers: A single nucleotide polymorphism that may cause splice site activity and affect gene function due to codon mutation at position 14604 of the chicken CRBP1 gene. .2REGION: 6984276..7001797) as a reference, using Primer5.0 to design PCR primers capable of amplifying the 14604 site, the primer sequence M pair is: upstream primer: TAAATTTATAGTTGCGGTCAT (14480 ~ 14500), downstream primer: AGTTCCAGGTGACGGGTGAG (14780 ~14799). The length of the amplified fragment is 320bp. The blood samples of different strains and individuals were mixed into a DNA pool and then amplified with the pair of primers to obtain a fragment of the same size as the target fragment. After bidirectional sequencing and identification, it was compared with the sequence published by NCBI and found that there was a G / T at position 14604 polymorphism.

[0025] (2) Coll...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a testing method of hereditary variation of CRBPI (Cellular Retinol-Binding Protein Type I) gene of chicken, which comprises the steps of: extracting a genome DNA of a chicken blood sample; carrying out PCR (Polymerase Chain Reaction) amplification on the genome DNA, wherein the sequence of an upstream primer used in PCR amplification is TAAATTTATAGTTGCGGTCAT, and the sequence of a downstream primer is AGTTCCAGGTGACGGGTGAG; and carrying out gel electrophoresis on the amplification products and photographing the amplification products, and analyzing the electrophoresisresult, wherein the polymorphism of the 14604 locus G/T of the chicken genome is relevant to the egg laying traits (such as egg yield, breeding weight, first egg weight and the like), and the selected single nucleotide polymorphism locus is used for assisting breeding and can accelerate the breeding process of poultry.

Description

technical field [0001] The invention relates to a detection method of gene variation, in particular to a detection method and application of chicken CRBP1 gene genetic variation. Background technique [0002] Single nucleotide polymorphisms (singlenucleotide polymorphisms, SNPs) mainly refer to DNA sequence polymorphisms caused by variations at the nucleotide level of the genome, including single-base transitions, transversions, and single-base insertions / Missing etc. The main research object of the first-generation molecular marker restriction fragment length polymorphism (RFLP) is the DNA fragment length polymorphism caused by the difference of the restriction site; the second-generation molecular marker is a variable number of tandem repeats (VNTR), including minisatellites and microsatellites. Compared with the previous second-generation molecular markers, SNPs have the following characteristics: (1) Large number and high coverage density. It is estimated that one wil...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/68C12N15/11
Inventor 肖礼华朱庆赵小玲刘益平
Owner SICHUAN AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap